Answer:
A group of bacteria that accumulate in layers and secrete an protective extracellular material.
Explanation:
The biofilm is a natural way how the bacteria get together to survive in an ecosystem or in another living thing. They build little by little this kind of building with different layers of bacteria that secrets a polymer, this protection polymer could be useful to protect the colony or to be attach to another cell or to a tissue. In medicine and in veterinarian studies is interesting because can be useful to create a film to protect some injuries.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
I would expect them to perform similar.
Explanation:
Studies suggest that intelligence has a genetic component and can, in part, be passed from parent to child - but not only that. There are outer components that contribute to the formation of intelligent individuals. Better nutrition and more access to education would be possible explanations for the progressive increase in intelligence test scores over time.
Homozygous twins are those that are mainly characterized by similarity between individuals. These twins are formed from the same zygote, ie after the fertilization process. Because of this characteristic, they have the same genetic heritage and are therefore considered identical.
As the homozygous twins in their classroom have the same genetic heritage and attend the same environment, we can conclude that their intelligence is influenced by the same factors. For this reason, a teacher who taught these two brothers might have expectations that they would perform similarly in the classroom.
The feeding relationship<span> is the interactions that takes place between parent and child as they engage in food selection, ingestion, and regulation behaviors.</span>
Answer:
Synergism
Explanation:
Synergism means cooperation, and is a term of Greek origin (synergy). Synergy is a work or effort to accomplish a certain very complex task, and to be able to succeed in the end. Synergy is the moment when the whole is greater than the sum of its parts.
In physiology, synergism occurs when the effect of two or more combined chemical agents is greater than the sum of individual effects. Concerning hormones, synergism happens when two hormones must be present for the full expression of an effect. That is, two hormones act for a certain purpose.
Example: FSH (follicle stimulating hormone) and estrogen cause oocyte maturation, but this only occurs if neither acts in isolation.
