1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cestrela7 [59]
3 years ago
7

4(2x-3) = 3+8x-11 solve the equation for x.

Mathematics
1 answer:
gavmur [86]3 years ago
7 0
Double check your question

You might be interested in
Assume the sample is a random sample from a distribution that is reasonably normally distributed and we are doing inference for
e-lub [12.9K]

Answer:

a) Hence the endpoints of a t-distribution with 5% beyond them in each tail if the sample has size n=12 is ± 1.796.

b) Hence the endpoints of a t-distribution with 1% beyond them in each tail if the sample has size n=20 is ± 2.539.

Step-by-step explanation:

Here the answer is given as follows,

5 0
3 years ago
Leo bought 6 chew toys for his new puppy each chew toy cost $4 how much did Leo spend for the chew toys
Nikolay [14]
6*4 equals 24 bam easy mat
8 0
4 years ago
Read 2 more answers
Michael estimated his mass as 8 kilograms.Is his estimate reasonable?Justify your answer.
DerKrebs [107]
Yes, his estimate is reasonable. But only if Michael is less than 2 years old.
5 0
3 years ago
Read 2 more answers
Which of the following rational numbers is equal to 2 point 4 with bar over 4? twenty two over nine twenty four over nine twenty
qaws [65]

Answer:

Twenty two over nine.

Step-by-step explanation:

The bar over the 4 means that 4 is recurring .44444.........  It goes on with out bounds and is equal to 4/9.

So 2.4 = 2 4/9

= 22/9.

7 0
3 years ago
Read 2 more answers
Quick picture to find 3 x 2.7
Sav [38]
The answer is 8.1
.........................

8 0
4 years ago
Other questions:
  • AB and BC are perpendicular lines find the value of x.
    7·2 answers
  • What is 7,464,000.55 rounded to the nearest hundred thousand?
    14·2 answers
  • a fraction in which the greatest common factor of the numerator and the denominator is 1 is written in
    11·1 answer
  • What is 2 3/4 minus 1 1/2
    14·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • How do you find the area of a circle? Isn't it π and something?
    12·1 answer
  • Plz help I’m getting timed
    5·1 answer
  • Adding 0 to any number leaves it unchanged. For example a + 0 = a.
    6·2 answers
  • Calculate the mode of the data set {27, 33, 42, 26, 27, 41, 25, 40, 29). If there is no mode then state that.
    6·1 answer
  • Match the figures with thier name =D--------------C​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!