Answer:
Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.
Codons before mutation: ATG TGC GAA ACT TTG GCT
<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>
Explanation:
Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.
The Sequence before mutation ATGCTGCGAAACTTTGGCTGA
Codons: ATG CTG CGA AAC TTT GGC TGA
The Sequence after mutation ATGTGCGAAACTTTGGCTGA
Codons: ATG TGC GAA ACT TTG GCT
<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>
you can get them at gander mountain for like 10.00
Explanation:
Hemophilia is a disease that is characterized by an abnormal blood clotting process. There are many different proteins that are involved in the clotting process and a single mutation or change in one of them could result in serious effects. Hemophilia is characterized by an abnormal version of one of the many proteins involved in the clotting process, the proteins that are commonly affected are the coagulation factor 8 or 9 (VIII or IX). These abnormal proteins are caused by a mutation in the gene (within the DNA) that codifies for the production of each protein. In other words, a mutation in the part of the DNA, (gene F8) will lead to a dysfunctional coagulation factor VIII and a mutation in the gene F9 will lead to a dysfunctional coagulation factor IX. Importantly, these mutations could be inherited and could cause hemophilia. Therefore, an error in the DNA and subsequently, an error in the protein will cause hemophilia. Finally, it is important to mention that there are other types of hemophilia that are not caused by the above-mentioned mutations, such as acquired hemophilia.
Answer: no
Explanation: fire does not change its process to adapt to it's environment.
Answer:
The options showing the different given statements were not provided in this question; however, an orthopaedic nurse receives specialized education and training to care for patients with diseases and disorders of the musculoskeletal system. Therefore, an orthopedic staff nurse is required to have a knowledge of the following:
1. Orthopedic cases and surgical treatments for each.
2. Surgical site care and dressing.
3. Pain management.
4. Intravenous and Intramuscular drug administration.
5. Vital signs check and significant changes.
6. Post-op care of patient.
7. Casting
8. External fixation care
9. Neurovascular status monitoring
10. Traction
