1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marizza181 [45]
3 years ago
12

Need help with biology hw :

Biology
1 answer:
andreyandreev [35.5K]3 years ago
4 0
Because there is more oxygen in hydrogen peroxide
You might be interested in
How can a refute hypothesis lead to a new investigation
IrinaVladis [17]

A refute hypothesis is a hypothesis that has been refused, not accepted.

When a hypothesis is refused, the scientists that proposed it will try to correct it or to create a similar more applicable one, and that is how new investigations could occur in this case.


Hope it helped,


BioTeacher101

6 0
4 years ago
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
......................................................peridot​
Ilya [14]

Answer:

It's C. They are mostly made up of hydrogen and helium

4 0
3 years ago
WHY IS CARBON IMPORTANT IN CYCLE OF NATURE
Lady bird [3.3K]

Answer:

It is important for plants because they use carbon as part of there process when they photosynthesize.

Explanation:

4 0
3 years ago
(GIVING BRAINLIEST!!)<br><br> What type of moisture does Colder air hold than hotter air?
uranmaximum [27]

Answer:

A oft-repeated water vapor myth is that warm air can “hold” more water vapor than cool air because as the air warms its molecules move farther apart, making room for more molecules

I hope this helps!

7 0
3 years ago
Read 2 more answers
Other questions:
  • Which electromagnetic wave has wavelengths ranging from the size of a printed period to the length of a pen (1..*.10 È³ to 1..*.
    13·2 answers
  • What properties DO NOT require a tool?
    12·1 answer
  • Which of the following is not a primary body tissue?<br> bone<br> nervous<br> connective<br> muscle
    9·1 answer
  • The parents of a 13-year-old boy with a sore throat for a week, vomiting for two days, swollen lymph glands, and stiff achy join
    7·1 answer
  • Which organisms represented below are heterotrophic?
    12·1 answer
  • You watch a scientist dissolve some sugar in a liter of water and then place some of this solution into a dialysis bag, tying bo
    13·2 answers
  • A liter is the same as a ____. A) cubic centimeter. B)cubic decimeter C)cubic meter D)cubic decameter
    10·1 answer
  • When dry cold canadian air displays very humid air what change occurs to the air pressure
    10·1 answer
  • Match each description to the appropriate tool. measures a variety of data, including pH levels and conductivity measures temper
    9·2 answers
  • Which amino acid sequence is coded for by the mRNA segment AUG-CCC-CAC-GAA-UAC?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!