1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
3 years ago
10

A ______ would be a short-term energy source. (Please Help!) :)

Biology
1 answer:
iragen [17]3 years ago
4 0

Answer:

lightbulb?

Explanation:

a lightbulb will run out but can last a while

You might be interested in
Fill in the blank<br> ___diffision involves transport proteins
stellarik [79]

Answer:

Facilitated diffusion involves transport protein

Explanation:

4 0
2 years ago
When there is too much carbon in the atmosphere, the hydrosphere, mainly oceans, absorb most of it to balance it out
castortr0y [4]
If you are asking for true or false, true
8 0
3 years ago
Read 2 more answers
How do organic compounds differ from in organic compounds
Leona [35]
The main difference<span> is in the presence of a carbon atom. O</span>rganic compounds<span> will contain a carbon atom.</span><span> Do you have answer choices?</span>
6 0
3 years ago
Earth's troposphere, hydrosphere, and lithosphere contain relatively large amounts of which
V125BC [204]
Nitrogen could be the answer
8 0
3 years ago
In which situation is it acceptable for an IT professional to access corporate secrets?
poizon [28]

Answer:

when she or she is the last hope of the surveillance or the intelligence

5 0
3 years ago
Other questions:
  • What does it mean for water to have a high specific heat?
    8·2 answers
  • Explain why you can't fully test the lipase activity in tube 5.
    9·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What does an urn-shape age pyramid represent???
    6·1 answer
  • Which of the following order is correct in terms of the hierarchy of the organization?
    7·2 answers
  • What feature of DNA replication makes it semi-conservative?
    5·2 answers
  • Hey scientist observes that a species of insect appears to be more numerous during dry summers then wet summers. Which is the ne
    14·1 answer
  • This illustration shows a strand of mRNA and the complimentary tRNA molecules that can base pair with the mRNA codons. What is t
    9·1 answer
  • Explain the function of enzymes and how enzymes<br> can be denatured.
    12·1 answer
  • Why do some flowers have so many pollen grains and ovules?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!