1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
leva [86]
3 years ago
6

Biologists have discovered ways ______ can reduce the symptoms of diseases.

Biology
1 answer:
Law Incorporation [45]3 years ago
8 0
Biologists have discovered ways B. Diets can reduce the symptoms of diseases.
You might be interested in
Memory B-lymphocytes are part of
vlabodo [156]
I’m guessing it’s probably A or C
3 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
7.
timama [110]

Answer:

individuals of the same species that live in the same area

3 0
2 years ago
Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?
Olegator [25]

Answer:

i dont know i need points

Explanation:

4 0
2 years ago
A scientist has chosen to study how rain can cause flooding along the Mississippi River. Which type of model is most appropriate
masha68 [24]
Is there a list of answers you can choose from?
3 0
3 years ago
Read 2 more answers
Other questions:
  • Where is extra food stored in a plants?
    14·2 answers
  • How do cellular structures interact to maintain homeostasis
    9·1 answer
  • How does CO2 enter a plant?
    7·1 answer
  • How do the scientists Mendeleev and Moseley differ on their arrangement for the periodic table?
    5·1 answer
  • Rough er is connected to the_________ membrane and to ______ er
    5·1 answer
  • Which of the following is NOT a function of proteins?
    14·1 answer
  • What is the main difference between a cladogram and a phylogenetic tree?
    13·1 answer
  • Which best describes viruses?
    14·1 answer
  • What happens when a proton is added to the nucleus of an atom
    15·1 answer
  • Describe the process of a diffusion and osmosis in daily life biological processes.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!