1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iogann1982 [59]
3 years ago
12

2. Science begins with an

Biology
1 answer:
mixas84 [53]3 years ago
3 0

Answer:

the answer is...

they start with observations on the object, then make a hypothosis!

  hope this helps:)

Explanation:

You might be interested in
The very structured cells may viewed with a light compound microscope.
irakobra [83]

Answer:

These cells are Eukaryotic and are autotrophic

Explanation:

These are the cells of onion. An oinion is a plant and because it is a plant it is autotrophic meaning they make their own food. Also plants are eukaryotic which means they have a nucleus.

5 0
2 years ago
In Wisconsin, a very large population of lake trout, in which individuals mate at random, experiences no migration, mutations, n
Pavlova-9 [17]
In this kind of population, the make up of the population's gene pool will remain virtually the same as long as these conditions hold. In this kind of situation, no evolution can take place, all thing will remain the same. For evolution to occur, competition must exist.
6 0
3 years ago
How do mammals differ from other reptiles and amphibians? Mammals do not teach their young to hunt. Mammals provide shelter for
Contact [7]

Answer:

Mammals give live birth to their offspring. Reptiles and amphibians lay eggs. Mammals are also usually warm blooded while reptiles and amphibians are cold blooded. Most amphibians and reptiles abandon their young at a certain age while most mammals will take care of their offspring forever.

Explanation:

:)

7 0
3 years ago
Read 2 more answers
g The Electron Transport Complex (ETC) consists of four proteins. How many of these proteins directly contribute to the proton g
vladimir2022 [97]

Answer:

Three proteins directly contribute to the proton gradient by moving protons across the membrane

Explanation:

The Electron transport chain is a group of proteins and molecules incrusted in the internal mitochondrial membrane and organized into four complexes, I, II, III, and IV. These complexes contain the electron transporters and the enzymes necessary to catalyze the electron transference from one complex to the other. Complex I contains the flavine mononucleotide -FMN- that receives electrons from the NADH. The coenzyme Q, located in the lipidic interior of the membrane, conducts electrons from complex I and II to complex III. The complex III contains cytochrome b, from where electrons go to cytochrome c, which is a peripheric membrane protein. Electrons travel from cytochrome c to cytochromes a and a3, located in the complex IV. Finally, they go back to the matrix, where they combine to H+ ions and oxygen, to form the water molecule. As electrons are transported through the chain, protons are bombed through three proteinic complexes from the matrix to the intermembrane space. These are complexes I, III and IV.  

6 0
2 years ago
What term is used to describe the relationship of the DNA strands to each other?
xxTIMURxx [149]

Answer:

The correct answer will be option-B.

Explanation:

Deoxyribose nucleic acid or DNA is the genetic material of the organism which is made up of nucleotide monomer. The structure of DNA is made up of two strands of nucleotides coiled in a helical structure thus providing a double-helical shape to the structure.  

Each nucleotide of a strand is composed of a five-carbon sugar, phosphate group and nitrogenous bases. These molecules are arranged in anti-parallel fashion in DNA which provides the polarity to the DNA strand. One strand is read from the 5' to 3' direction whereas another form 3'to 5' direction.

Thus, Option-B is the correct answer.

7 0
2 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which is an internal stimulus
    8·2 answers
  • Why was the discovery of a natural clock so important
    8·1 answer
  • Which factor may help begin an ice age? Select all that apply
    10·1 answer
  • In his experiments with different competing pairs of Paramecium species, Gause found that sometimes both species persisted and s
    15·1 answer
  • Plant cells have cell walls, but animal cells don’t. Why might that be?
    10·1 answer
  • Is there a difference between radial and spherical symmetry? If so, what is the difference?
    6·1 answer
  • Describe how the circulatory system allows the endocrine system to do its job?​
    7·1 answer
  • What is the most direct evidence in this photo of millions of years of deposition?
    13·2 answers
  • What was the total maginification (25 points)
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!