1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bekas [8.4K]
3 years ago
11

Which of the following correctly describes what a mutation is?

Biology
1 answer:
nexus9112 [7]3 years ago
4 0

The answer is D, all of the above.

You might be interested in
Which of the following is an example of diffraction?
makkiz [27]

<u>Answer:</u>

You try to pick up a shell in the water but it isn't where it appears to be is an example of diffraction

<u>Explanation:</u>

Diffraction refers to the light bending that happens as the light passes about the edge of some object. How much bending takes place is found by the size of wavelength of light relative to that of opening. If the opening is larger than the wavelength of light, then bending will not be noticeable.

Since, light gets diffracted due to water hence the shell kept inside the water appears to be at a different position than where it actually is

8 0
3 years ago
Contrast mitosis and cytokinesis
lyudmila [28]

Answer:

why

Explanation:

8 0
3 years ago
How do secondary consumer obtain their energy? <br><br>Please someone help me ​
Orlov [11]

Answer:

Consumers must obtain their nutrients and energy by eating other organisms. Decomposers break down animal remains and wastes to get energy.

secondary consumer obtain their energy by eating or consuming primary consumers.

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Classify the organisms based on how they obtain food.
Snezhnost [94]

everything except for the carrots, trees and the ocean picture of algae is under heterotrophs

8 0
3 years ago
Read 2 more answers
Other questions:
  • Sounds in the external ear depends on vibration of movable bones.
    8·2 answers
  • What structure holds chromatids together in double stranded chromosomes? What are they known as
    7·1 answer
  • In labrador retrievers some puppies have pink nose and some have black labrador retrievers with black for almost always have bla
    13·2 answers
  • When in the presence of sugar, Yeast perform wich process?
    10·2 answers
  • By which process do plants lose their water to the atmosphere?
    5·1 answer
  • Please explain to me the mechanism of hearing...
    14·1 answer
  • Bonus Problem, for 5 bonus points: If you could have any job in Anthropology, what would you do, and why?
    6·1 answer
  • The frequency of a lethal allele in a population is greatest when it is: Group of answer choices dominant manifested in infancy
    14·1 answer
  • Brainliest perhaps. If China has a population of 1,355,935,022 people and an area...
    5·1 answer
  • Which are reactants of photosynthesis?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!