1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexandr1967 [171]
3 years ago
15

A couple in Indiana are each heterozygous for the autosomal recessive allele for albinism. They have two children. What is the p

robability that both children will be phenotypically identical with regard to skin color?
Biology
1 answer:
irinina [24]3 years ago
4 0

Answer:

Probability that both children will be phenotypically identical with regards to skin color is 10/16.

Explanation:

The couple has a heterozygous genotype for the recessive allele. Representing the recessive allele with 'a' and the dominant allele with 'A', we can write the heterozygous genotype for the couple as Aa.

The gene pool of the children for this couple can be represented as:

Alleles       A        a

A              AA       Aa

a               Aa       aa

There can result 4 combinations of alleles AA,Aa,Aa and aa. The recessive allele is responsible for albinism so the child with the allele set 'aa' will have albinism while the others, AA,Aa and Aa will show no signs of albinism since the recessive allele is responsible for it.

The probability that both children will be phenotypically identical can be calculated by first considering that the children show albinism and then consider the probability that they have a normal phenotype.

Probability that a child will have albinism (aa) = 1/4

Probability that a child will not have albinism (AA, Aa and Aa) = 3/4

Probability that both children have albinism = 1/4 x 1/4 = 1/16

Probability that both children will have no albinism = 3/4 x 3/4 = 9/16

Probability that both children will be phenotypically identical = 1/16 + 9/16

                                                                                                      = 10/16

Probability that both children will be phenotypically identical with regards to skin color is 10/16.

You might be interested in
Which of these is NOT a type of local wind?<br> A. Valley<br> B. Glacier<br> C. Mountain<br> D. Sea
Tresset [83]

Answer:

B. Glacier

Explanation:

Sea breezes, land breezes, mountain breezes, and valley breezes are all types of local winds. Glacier are NOT related

---------------------------------------------------------

<u><em>Hope this help :)</em></u>

6 0
2 years ago
Which physical assessment of the skin indicates that a client is addicted to phencyclidine?
kifflom [539]
Red and dry skin. (I'm a Nursing major)
4 0
3 years ago
What would be expected to lower the Tm for a phospholipid bilayer?
Rama09 [41]

Answer:

Replacing a lipid containing 18 C fatty acids with one containing 16 C fatty acids.

6 0
3 years ago
What is the result of a mutation during meiosis?
galina1969 [7]

Answer:

A mutation is a change in the nucleotide sequence of the DNA in a cell. ... Mutations can occur before, during, and after mitosis and meiosis. If a mutation occurs in cells that will make gametes by meiosis or during meiosis itself, it can be passed on to offspring and contribute to the genetic variability of the population.

Explanation:

hope this help....

    。    •   ゚  。

 .   .      .  。    •   ゚  。

    。   。 . 。    •   ゚  。

 .   。  ඞ 。  . • 。    •   ゚  。

alexisatcher was not the imposter

  • .  。 . 。    •   ゚  。

 。      ゚  。    •   ゚  。

 .     . 。    •   ゚  。

    ,    .  .   . 。 。    •   ゚  。

4 0
3 years ago
Describe an organism that uses both asexual and sexual reproduction.
kondaur [170]

Answer:

Also, many living things have evolved to use both asexual and sexual means of reproduction. For example aphids, slime molds, sea anemones, and some starfish are capable of both asexual and sexual reproduction

Explanation:

3 0
2 years ago
Other questions:
  • In which direction is the Pacific Plate moving in relation to the North American Plate?
    14·2 answers
  • A yeast associated with leukemic patients that produces arthrospores is
    12·1 answer
  • If a cell has 18 chromosomes how many chromosomes would each daughter cell have after mitosis
    8·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Choose all of the responses that pertain to the relative burden of human infectious diseases in the world today.
    15·1 answer
  • This Irrigation system is very accurate on water application and can cover large field space, yet it is one of the most expensiv
    7·1 answer
  • I need help guys!! ​
    15·1 answer
  • Which of the following is NOT an example of a pre-zygotic barrier?
    14·1 answer
  • Which of the following describes fertilization? (1 point)
    15·2 answers
  • A woman is heterozygous for a rare dominant autosomal genetic disease, neurofibromatosis. she marries a normal man (homozygous r
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!