In a cell, there are several parts of it that are there to stop this from happening. Cancerous cells do not have the genetic code to stop growing and reproducing. A regular cell will actually destroy itself it there is a mutation. If it does not get destroyed, it could potentially be tumorous, then it could eventually be cancerous.
A. The sun
Abiotic means fake or not living. Trees, grass, and people are living, also know as biotic. The sun is not living, it’s just a ball of hot gas, which is not living.
<span>The labs were unable to reproduce the pharmaceutical company’s data
An important characteristic of scientific experiments is that their results can be replicated. In this case, assuming that the laboratories followed the same procedure as the pharmaceutical company, the fact that the data could not be replicated means that the company's claims are invalid. The validity of the claims is more questionable given the huge difference in the final conclusions, with the company reporting a 35% decrease, while the maximum decrease observed by the labs was 8%.
</span>
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
