1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
6

How does groundwater form

Biology
1 answer:
Svetlanka [38]3 years ago
4 0
By build up of water falling from the sky.
You might be interested in
During El Niño, warm water moves from Australia to the coast of South America. Which change does this cause to Australia?
Brrunno [24]

Answer: burning organic matter

Explanation:

8 0
3 years ago
The tRNA for GUCAUCGAUCGAUCGGAUGCC
Lapatulllka [165]

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

3 0
3 years ago
Are the lab results of the blood sample normal? Which values are normal and which are not? (Refer to the chart of Nikoleta's res
Masteriza [31]
The lab results of the blood sample are not normal. Nikoleta’s red blood cell and platelet count are within the “normal” range, but her hemoglobin, mean corpuscular count and white blood cell count are either above of below “normal”.
5 0
3 years ago
Importance of plants from an economic, nutritional, environmental and medicinal point of view
Inga [223]

Answer:

Plants are extremely important in the lives of people throughout the world. People depend upon plants to satisfy such basic human needs as food, clothing, shelter, and health care. These needs are growing rapidly because of a growing world population, increasing incomes, and urbanization .

Plants provide food directly, of course, and also feed livestock that is then consumed itself. In addition, plants provide the raw materials for many types of pharmaceuticals, as well as tobacco, coffee, alcohol, and other drugs. The fiber industry depends heavily on the products of cotton, and the lumber products industry relies on wood from a wide variety of trees (wood fuel is used primarily in rural areas). Approximately 2.5 billion people in the world still rely on subsistence farming to satisfy their basic needs, while the rest are tied into increasingly complex production and distribution systems to provide food, fiber, fuel, and other plant-derived commodities .

Medicinal plants have been used in healthcare since time immemorial. Studies have been carried out globally to verify their efficacy and some of the findings have led to the production of plant-based medicines. The global market value of medicinal plant products exceeds $100 billion per annum. This paper discusses the role, contributions and usefulness of medicinal plants in tackling the diseases of public health importance, with particular emphasis on the current strategic approaches to disease prevention. A comparison is drawn between the ‘whole population’ and ‘high-risk’ strategies. The usefulness of the common-factor approach as a method of engaging other health promoters in propagating the ideals of medicinal plants is highlighted.

5 0
3 years ago
Suppose that meiosis occurred in the mother and father whose chromosomes you labeled in question 1. During meiosis,
Flura [38]

Explanation:

you will end up with 24 chromosomes instead of the standard 23 and have down syndrome

7 0
2 years ago
Other questions:
  • Which membrane contains atp synthases in gram positive or in gram negative bacteria?
    7·1 answer
  • Identify the highlighted muscle (muscular system, upper limb)
    13·1 answer
  • Describe a medical advance that has led to a decrease in the spread of communicable diseases. What is the advance? How does it p
    14·2 answers
  • Identify five changes in medcial care over the past years that have affected the profession of medical assisting.
    15·1 answer
  • Along the northwestern coast of the United States, the Juan de Fuca Plate is being pushed underneath the North American Plate, c
    6·1 answer
  • which statement best describes the results of DNA replication A) two identical DNA molecules B) one DNA molecule C) messenger RN
    15·2 answers
  • What determines the function of a specialized cell?
    10·1 answer
  • A chloroplast is releasing large amounts of oxygen. What does this tell you about what other processes are going on inside the c
    10·1 answer
  • Is there anyone who can define SAP​
    11·1 answer
  • What is the phenotype for females
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!