1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sveta [45]
3 years ago
11

Can someone help me with this, please?

Biology
1 answer:
Andrei [34K]3 years ago
4 0

Answer:

It is an aerobic respiration

Explanation:

It occur in the presence of oxygen

Aerobic respiration produces more ATP than anaerobic

You might be interested in
In dogs, wire hair is due to a dominant gene (W), smooth hair id due to its recessive allele.a. If a homozygous wire-haired dog
Vsevolod [243]

Answer:

a) All the offspring produced would be a heterozygous in the first generation (F1 generation) with genotype: Ww, Ww, Ww, and Ww. Since wire hair is dominant, all would be wired haired.

b) In the F2 (second generation), we breed the heterozygous offspring from the F1 generation together (Ww x Ww). This will produce 3:1 ratio of dominant:recessive phenotypes having 3/4 of the offspring wire-haired (1/4 WW homozygotes and 1/2 Ww heterozygotes) and 1/4 will be smooth-haired (ww). Also the genotype would have the ratio 1:2:1 (i.e 1 homozygote WW, 2 heterozygote Ww and 1 smooth hair)

c) the chances of producing a smooth-haired pup is 1/4, and the chances of producing a wire-haired pup are 3/4.

d) Therefore, 1/2 of the offspring will have the genotype Ww and be wire-haired, and 1/2 of the offspring will be ww and be smooth-haired.  Also the phenotype ratio is 1:1 (1/2 is heterozygote wired hair and 1/2 is smoth haired)

Explanation:

Since the wire hair is the dominant gene (W) and smooth hair (w) is the recessive allele

a)  If a homozygous wire-haired dog is mated with a smooth-haired dog, All the offspring produced would be a heterozygous in the first generation (F1 generation) with genotype: Ww, Ww, Ww, and Ww. Since wire hair is dominant, all would be wired haired.

b) In the F2 (second generation), we breed the heterozygous offspring from the F1 generation together (Ww x Ww). This will produce 3:1 ratio of dominant:recessive phenotypes having 3/4 of the offspring wire-haired (1/4 WW homozygotes and 1/2 Ww heterozygotes) and 1/4 will be smooth-haired (ww). Also the genotype would have the ratio 1:2:1 (i.e 1 homozygote WW, 2 heterozygote Ww and 1 smooth hair)

c) If two wire-haired dogs produce a smooth-haired pup, that means that both parents must be heterozygotes (Ww) having a pair of dominant W allele and recessive w allele to pass on to the offspring. Therefore, if these two dogs were to mate again (Ww x Ww), the chances of producing a smooth-haired pup is 1/4, and the chances of producing a wire-haired pup are 3/4.

d) If the mother of the wire-haired male was smooth-haired, that means that the recessive allele w had been passed on to the male making the male a   heterozygote (Ww). When this male mates with a smooth-haired female (ww), the cross is Ww x ww. Therefore, 1/2 of the offspring will have the genotype Ww and be wire-haired, and 1/2 of the offspring will be ww and be smooth-haired.  Also the phenotype ratio is 1:1 (1/2 is heterozygote wired hair and 1/2 is smoth haired)

8 0
3 years ago
Name an organ that made up of smooth<br> muscles.
Lina20 [59]

Answer: digestive system

Explanation:

5 0
3 years ago
Read 2 more answers
Where is amylase produced in the body
miskamm [114]

Answer: Salivary glands

Explanation:

8 0
3 years ago
What is a major challenge of current space exploration?
lord [1]
<span><u>B. setting a clear goal for the future </u></span>
7 0
3 years ago
Read 2 more answers
Scientists observed that when two closely related species of predatory birds live in different areas, they seek prey early in th
vivado [14]
The answer should be A Ecosystem
4 0
4 years ago
Other questions:
  • A client with intermittent claudication has been instructed to stop smoking and doesn't understand why this is necessary. which
    10·1 answer
  • Select all the correct answers.
    13·2 answers
  • Taxonomy is the science that helps us understand?
    7·1 answer
  • You are a biologist on a trip to an island in the south pacific. while on the island, you are allowed to collect dna samples fro
    11·1 answer
  • Risk of using bio pharmaceuticals
    8·1 answer
  • Water has the ability to dissolve salts and carry dissolved carbon dioxide. How does
    12·1 answer
  • Hii! i’ll give brainliest pls help
    9·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • (03.05 MC)<br> In which of the following ways is DNA replication similar to transcription?
    5·1 answer
  • What are chromoplasts and their functions? ​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!