1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lelechka [254]
3 years ago
6

Lipids function mainly as?

Biology
1 answer:
tatuchka [14]3 years ago
4 0
Lipids are fat's so they are energy more than carbohydrates 
You might be interested in
Mercury has a density of 13.5 g/cm^3. What would an object's density have to be for it to sink in mercury?
Lostsunrise [7]
It would have to have a density greater than the density of Mercury. For example, if an abject had a density of 14.5 g/cm^3, it would sink when put in Mercury. Hope this helps! :D
5 0
3 years ago
The production of ammonia in the reaction catalyzed by glutamate
amid [387]

Answer:

The correct answer is - option C.

Explanation:

Glutamate dehydrogenase is also known as GDH which present in most of the microorganisms or the mitochondria of eukaryotic organisms. It is the only enzyme that can use both NAD+ and NADP+.

Glutamate dehydrogenase is inhibited by the GTP or ATP. One of the main causes of the catabolism amino acid is metabolites for gluconeogenesis. If the gluconeogenesis is likely to be active due to the result of when glutamate dehydrogenase is active.

Thus, the correct answer is - option C.

4 0
3 years ago
Can bacteria be viewed with a light microscope?
yawa3891 [41]
Yes it can but there are some issues to using a light microscope such as they are transparent so it’s best to use a prepared slide which has been stained.
7 0
3 years ago
Read 2 more answers
To explain why the data support or reject the hypothesis
aleksandrvk [35]
A proposal Intend to explain certainly facts or observation
3 0
3 years ago
If there was a dramatic increase in skeletal muscle cell damage and apoptosis, what would you expect to happen to levels of myog
leva [86]

If there was a dramatic increase in skeletal muscle cell damage and apoptosis, I would not expect a change in blood myoglobin and CK levels, because these markers are linked to cardiac muscle damage.

<h3>What does high CK-MB mean?</h3>

Elevated CKMB can be a sign of cardiac (heart muscle) damage or chronic kidney failure. At the onset of acute symptoms, after cardiac peaks, CKMB values ​​are elevated after 3-6 peaks after 12-24 hours between 12-24 hours, values ​​at 24-48-48.

With this information, we can conclude that if there was a dramatic increase in skeletal muscle cell damage and apoptosis, we would not expect a change in blood myoglobin and CK levels, because these markers are linked to cardiac muscle damage.

Learn more about myoglobin in brainly.com/question/8111632

7 0
2 years ago
Other questions:
  • The most effective molecule for nitrogenous waste disposal in desert animals would be __________.
    7·1 answer
  • What stage in meiosis does crossing over occur?
    15·2 answers
  • An organism’s habitat must provide all of the following EXCEPT
    10·2 answers
  • The phosphorous cycle is responsible for producing acid rain.<br><br> True or false
    7·2 answers
  • A short mRNA sequence is shown in the box below. Determine the DNA sequence from which this mRNA sequence was transcribed.
    11·2 answers
  • What three particles make up atoms?
    14·2 answers
  • A virus is a... <br><br> A. Host <br> B. Producer <br> C. Consumer<br> D. Intracellular Parasite
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Describe the fate of pyruvate and nadh produced by glycolysis​
    11·1 answer
  • In examining an unknown animal species during its embryonic development, how can you be sure what you are looking at exhibits pr
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!