1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
3 years ago
9

The one-celled eukaryotic organisms above are often found in freshwater ponds. What is one

Biology
1 answer:
Leno4ka [110]3 years ago
6 0

Answer:

The correct option is A. Nucleus

Explanation:

The diagram in the question shows a paramecium, euglena and amoeba.

Paramecium can be describe as a fresh water animal which has a body covered with cilia. Flagellum and Pseudopodia​ lack in paramecium

Amoeba can be described as single celled organisms which have Pseudopodia for movement and shape changing.

Euglena is a single- celled organism capable of living is salt water as well as fresh water. It contains flagellum for movement but lacks cilia and Pseudopodia.

The structure common in all these organisms is the nucleus. Nucleus is present in every eukaryotic organism.

You might be interested in
At carrying capacity, the number of organisms being born equals the number of organisms _____.
Pepsi [2]
Dying would be the answer
5 0
3 years ago
The earth’s surface stays completely the same over time. It never changes
7nadin3 [17]
False!! all of earth’s components, including it’s surface, are always always changing
6 0
3 years ago
Spontaneous generation does not support cell theory because
zepelin [54]
<h2>Answer</h2>

Spontaneous generation does not support cell theory because

  • <u>A. All cells arise from preexisting cells</u>

Correct me if I'm wrong

<h3>#CarryOnLearning</h3>

\mathfrak{WatanabeHaruto}

7 0
3 years ago
Which fuel has the shortest span of renewability?
Arte-miy333 [17]
<span> It's solar, because s</span>olar energy is a renewable resource that is virtually endless as long as the sun shines.<span />
6 0
3 years ago
Read 2 more answers
Calcium oxide (CaO) forms when an atom of calcium loses two electrons, giving it a +2 charge and an atom of oxygen picks up two
11111nata11111 [884]
Calcium oxide based on the above explanation is an ionic compound.
8 0
4 years ago
Other questions:
  • For a DNA strand that contains the sequence AGT in the 5’ to 3’ direction, what nucleotides are found on the other DNA strand in
    10·1 answer
  • You are examining another neuron, and find that it has two processes, both of which generate action potentials. What is the stru
    7·2 answers
  • What type of frog has translucent skin
    14·2 answers
  • What's the best of Use uterus and vagina in the same sentence
    12·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the importance of autotrophic organisms for other organisms?
    13·1 answer
  • You perform a test cross of the dihybrid AaBb and score the phenotypes of 1000 progeny. Assuming independent assortment, how man
    11·1 answer
  • How does blood flow through the heart?
    11·1 answer
  • What is the cellular process of sexual reproduction
    15·1 answer
  • Which is a series of substances along which electrons are transferred, releasing energy?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!