1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
7

Jennifer eats junk food and drinks sodas daily and rarely eats any fresh fruits, vegetables, or dairy products. She does not tak

e any multivitamins because she feels perfectly healthy. Her physician warns her of the risk of having an imbalance of calcium and phosphate levels. What would be occurring in Jennifers body if she is found to have low levels of calcium and high levels of phosphate?
a. Decreased activation of vitamin D in the kidneys
b. Increased excretion of phosphate in the kidneys.
c. Increased reabsorption of phosphate in the kidneys
d. Increased deposition of calcium into the bones.
Biology
1 answer:
Minchanka [31]3 years ago
3 0

Answer:

c. Increased reabsorption of phosphate in the kidneys

d. Increased deposition of calcium into the bones.

Explanation:

Hyperphosphatemia is a condition that is expressed particularly in people with a kidney dysfunction. It comprises the kidneys, which do not excrete enough phosphate from the body as they reabsorbe it and thus leading to increased phosphate levels.

Also, phosphate binds calcium with high affinity, provoking acute hypocalcemia (decreased levels of calcium). In Hyperphosphatemia, calcium is being deposited mostly in the bone but also in the extraskeletal tissue.

You might be interested in
5 facts about the reproductive system
svp [43]
<span>After you ovulate, your egg is fertile for between 24 to 48 hours and a man’s sperm can survive in the female body for 48 hours. There have actually even been documented cases of live sperm surviving in the female reproductive system for eight days after intercourse!One breast is always larger than the other. Most of the time, it goes without notice but it is typical for breast size to be slightly mismatched. Some women can be born with two uteruses or two vaginas and have no idea until they notice abnormal menstruation or excessive bleeding. You are born with all the eggs you will ever have in a lifetime which can be anywhere from thousands to millions however, only about 300 to 400 of these eggs will mature and be released for fertilization. <span>You ovaries take turns each month releasing eggs.</span></span>
4 0
4 years ago
How does overfishing affect the coral reef/ocean
agasfer [191]
<span>The impacts from unsustainable fishing on coral reef areas can lead to the depletion of key reef species in many locations. Such losses often have a ripple effect, not just on the coral reef ecosystems themselves, but also on the local economies that depend on them. Additionally, certain types of fishing gear can inflict serious physical damage to coral reefs, seagrass beds, and other important marine habitats.

hope that helps:)</span>
6 0
3 years ago
Read 2 more answers
Given the number of oscillations a wave completes in a period of time, you can determine the amplitude. wavelength. frequency. e
Advocard [28]
I believe it is the frequency, because when a oscillation occurs that is the starting point to determine when another wave is to come.
4 0
3 years ago
Read 2 more answers
A heterozygous wild-type male drosophila with red eyes is crossed with a homozygous mutant female with white eyes. what is the r
Anni [7]
It should be 50/50 if the male would be Rr for heterogenous male red and the female rr for homogenous for white.
3 0
3 years ago
What are the four main groups of protozoans?
raketka [301]
The following are the four main gorups
1-Protozoans with Pseudopods
2-Ciliates
3-Flagellates
4-<span>Parasitic Protozoans</span>
5 0
4 years ago
Other questions:
  • Which cells of bones secrete the matrix of Haversian canal?Select one of the options below as your answer: A. Osteoclasts B. Ost
    7·1 answer
  • Eggs are developed and released by the<br> Sperm is produced by the
    5·2 answers
  • A scientist looked at a group of embryos. Upon examination, she observed that species A and B diverged closer to fertilization.
    13·2 answers
  • ) You treat some cells with a proteolytic enzyme that is too large to penetrate the cell membrane (Set 1). Another group of cell
    15·1 answer
  • Which of the following is an autotrop
    5·1 answer
  • These cancers represent the most common cancers in the United States.
    7·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Any advice on how to score a 4-5 on this years ap biology exam? My teacher didn’t teach and I’m really struggling
    9·1 answer
  • Select the correct answer. Anna’s mother prepares sauerkraut, a fermented dish made from finely cut cabbage and salt. Lactobacil
    7·2 answers
  • Helppppppoppppppppppppppppppppppppppp
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!