1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

Explain why a hydrogen atom can become either an ion or a part of a molecule

Biology
1 answer:
AleksandrR [38]3 years ago
8 0
Because a atom can join my nuts and I will have 3 nuts.?YOUR WELCOME JK
You might be interested in
Excess post-exercise oxygen consumption is the extra amount of oxygen consumed after the completion of exercise and before respi
Scilla [17]

The extra oxygen is used to restore muscle fibers to their pre-exercise state by doing all of the following except facilitating calcium release from the sarcoplasmic reticulum in the muscle fiber. Thus, the correct option is B.

<h3>What is Respiration?</h3>

Respiration may be defined as the process of acquiring oxygen from outside the body and utilizing it in the process of breakdown of food sources for cellular needs.

The extra oxygen works in the muscle fiber by replenishing the ATP, restocking the myoglobin, and supplying the ATP used to replenish glycogen stores in the muscle fiber.

Therefore, the correct option for this question is B.

To learn more about Respiration, refer to the link;

brainly.com/question/18169685

#SPJ1

5 0
2 years ago
Fungi are responsible for what common human ailment? colds the flu athlete's foot infections
Andreas93 [3]
Fungi are responsible for what common human ailment athlete's foot infections
5 0
3 years ago
Which of the following cell components are most involved in determining an organism’s traits?
kati45 [8]

Answer:

I believe its B or D

Explanation:

5 0
3 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
How is matter conserved in the water cycle
notka56 [123]

Answer:

Matter is conserved because atoms are conserved in physical and chemical processes. As complex as the water cycle is, water molecules are conserved and endlessly recycled in nature. Conservation of mass is a physical law that s never broken.This cycle continues with no loss of water.

6 0
3 years ago
Other questions:
  • Which is required for the light-independent reactions in photosynthesis to occur?
    9·1 answer
  • When scientist study populations they examine the presence of alleles within the population. Scientist can then use the allele f
    15·1 answer
  • When the body temperature is above 37 degrees c, what are two things that the scrotum will do to maintain homeostasis in the tes
    13·1 answer
  • Abiotic and biotic factors determine what an environment will be like. Abiotic factors include aspects such as temperature, mois
    10·1 answer
  • (Biology) Another 100 points ( ՞ਊ ՞)
    9·2 answers
  • Japan is made of a group of islands in the Pacific Ocean. This country is a(n): peninsula volcano dune archipelago
    7·1 answer
  • Approximately 75% of all breast cancers grow in response to
    7·1 answer
  • Write the general characteristics of bryophytes?​
    9·2 answers
  • If a stem of a plant was removed and placed in coloured water solution which structure would be stained?
    6·1 answer
  • The brain is in which part of the nervous system?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!