1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
adelina 88 [10]
3 years ago
6

When ADP gains a phosphate to form ATP,A.free energy is released by the loss of a phosphate.B.energy is consumed.C.the reaction

ends.D.chemical energy is converted to light energy.E.ribose loses an oxygen to become deoxyribose.
Biology
1 answer:
Shalnov [3]3 years ago
8 0

Answer:

B.energy is consumed.

Explanation:

When ATP gain phosphate the energy is consumed(ADP+ Pi+ free energy→ ATP+ H2O). So in the formation of ATP energy is used and consumed  and that energy is stored in the terminal phosphate bond.

This ATP act as the cellular form of energy and this energy is released when the terminal phosphate bond breaks and terminal phosphate is released from the ATP. This energy is used to perform the metabolic function required for cell survival and cell growth. Therefore energy is consumed in ATP formation.

You might be interested in
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
What theoretical perspective views society as having a system of interdependent inherently connected parts?
nekit [7.7K]

Answer:

Functionalism

Explanation:

Functionalism is the theoretical perspective in sociology, posits that for stability and social order to be established in a society, all social institutions that make up the society, must work interdependently to contribute to the functionality of the society. Social institutions in a society include, the government, family, economy, religion, media,education.

For example, for most societies that seem relatively stable, the family pay taxes to the government, the government as an institution rely on these taxes to provide education for the children of the family in that society.  All parts of this society are interdependently inherently connected.

3 0
3 years ago
Fast Reply!!!!<br> is it D????
PtichkaEL [24]
Yes, it is D.translation
It is the process in which proteins are synthesized by the ribosome in the cytosol
4 0
3 years ago
What is atomic mass 2
Sav [38]

Answer:

Deuterium

Explanation:

Deuterium is  an isotope of hydrogen with one proton and one neutron in its nucleus.

Thus it has a mass number 2.

5 0
4 years ago
Which temperature air would have the lowest pressure? (assuming all other factors are constant)
matrenka [14]
I believe it would be D because as temperature decreases so does pressure
5 0
3 years ago
Read 2 more answers
Other questions:
  • What must a animal do in order for cellular respiration to begin
    8·1 answer
  • In roses, red flowers and long stems are dominant traits. A rose plant that is homozygous for both red flowers and long stems is
    15·2 answers
  • The harmonic law would suggest that Neptune will take _____ to orbit the Sun than Mercury.
    12·1 answer
  • Why is DNA so important in a living organism?
    9·1 answer
  • Compare and contrast the role of nature d the natural world in two poems from this unit: Walt Whitman’s “Come Up from the Fields
    15·1 answer
  • Why is it impossible for offspring to show recessive trait if one parent is homozygous for the dominant trait?
    15·1 answer
  • Question 8(Multiple Choice Worth 1 points) (01.02 LC)What should you do if you see lightning while you are outside exercising? H
    13·1 answer
  • Which of the following is an example of an Si unit? A)foot B) Second C) Pound D) gallon
    5·1 answer
  • 14. Brainstorm and write at least 3 potential challenges or important points to consider when conducting the described
    11·1 answer
  • Florida course 3 elevate science book, on page 108, it says is there any matter in figure 1 that you cannot see, what is the ans
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!