1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
6

The Glaister Equation (36.9℃-T) X 6/5 =Time (hrs). A body with a temperature of 31.9 has been dead for approximately how long? *

Biology
1 answer:
olganol [36]3 years ago
3 0
0 hours (they just died)
You might be interested in
What is the monomer of a nucleic acid?
nlexa [21]

Answer:

Is D

Explanation:

Nucleic acids are giant biomolecules made of monomers called nucleotides. Nucleotides have three components: pentose sugar (5-carbon sugar), phosphate group, and nitrogenous base.

5 0
3 years ago
Read 2 more answers
Using land for agriculture and forestry can lead to soil erosion. Which of the
VLD [36.1K]
All of them are correct soil erosion turns grains of soil into mere grains of sand which when placed in water makes the water much cloudier, biodiversity will decrease as soil erosion leads to a more Barron and dry landscape, respiratory disease may be caused by inhaled particles of dust which can be create from soil erosion, and desertification as mentioned earlier soil erosion leads to a more baron and dried out landscape as the soil can’t hold water as much as it used too.
7 0
3 years ago
If molecules are small enough then
kakasveta [241]

sorry what this means¯\_(ツ)_/¯

6 0
3 years ago
When the body experiences a significant blood loss, the ________ produces the hormone erythropoietin to stimulate the production
yKpoI14uk [10]

Answer: Kidney

Explanation: The Kidneys produce the hormone in response to cellular hypoxia due to loss of blood.

4 0
3 years ago
I WILL GIVE BRAINLISIT!!!!!
Liono4ka [1.6K]

Answer: Because Isabel, where she lives, is salt water which contains salt.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • The fluid mosaic model describes the _____.
    10·2 answers
  • Which of the following is NOT a branch of natural science ?
    12·2 answers
  • During witch of the following stages of thunderstorms does precipitation begins
    13·1 answer
  • Help now! For biology
    12·1 answer
  • How is the food chain related to the web of life?
    9·2 answers
  • (50 POINTS) BEST ANSWER GETS BRAINLIEST!!!
    8·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Mr. and Mrs. Green have a daughter, Georgia, who was born at Riverside Community Hospital. Mr. and Mrs. Blue have a daughter, Be
    9·1 answer
  • 9. What process adds phosphorus to ADP?
    6·1 answer
  • Why is ETC considered an aerobic process?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!