1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ValentinkaMS [17]
4 years ago
14

An important characteristic of the earliest permanent human settlements was that _____.

Biology
1 answer:
alex41 [277]4 years ago
3 0

Answer: Gathered food was stored

Explanation: An important characteristic of the earliest permanent human settlements was that gathered food was stored. This allowed the settlements to survive better through harsh times, such as the winter. Also, by storing food less, hunters were needed for the settlement, and individuals began to focus and learn other trades to advance with civilization.

You might be interested in
Which of the following is an abiotic factor in an ecosystem?
lubasha [3.4K]

Answer:

water

Explanation:

All living organisms need water to intake and survive.

3 0
3 years ago
Read 2 more answers
Need some help please!!?
aleksklad [387]
D specialised cells are formed
4 0
3 years ago
The scientist who suggested that energy can be created under certain conditions was a. Newton. b. Einstein. c. Wright. d. Pascal
vivado [14]
Hey there!

The scientist that suggested that energy can be created under certain conditions was Einstein

Hope this helps!
4 0
3 years ago
Read 2 more answers
How is food and energy provided for skin cells
spin [16.1K]
Nutrients are delivered by the blood through the capillary network.
3 0
3 years ago
What is responsible for this change in taste? what is responsible for this change in taste? amylase breaks down the starch in th
NARA [144]

Amylase is  a protein made by your pancreas and by glands in and around your mouth and throat. It helps you break down carbohydrates and starches into sugar. It's normal to have some amylase in your blood. But too much of it could mean one of the ducts (tubes) in your pancreas is blocked or injured.

  • Amylase breaks down the starch in the cracker into glucose monomer  which stimulate sweet receptor in the tongue.
  • Amylase break down the glycogen in the receptor which stimulate the sweet receptor in the tongue.
  • Lyzozyme breaks down the cellulase in the cracker into glucose monomer which stimulate sweet receptor in the tongue.
7 0
4 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How do sponges reproduce?
    9·1 answer
  • What is a thery that has been proven true over time and and never disproven called
    9·1 answer
  • The process in which pressure from the upper layers of sediment pushes down on the lower layers, causing the sediments to stick
    8·2 answers
  • Walking along a mile-long path in the woods, you notice a stand of your favorite wildflower, the cardinal flower, three differen
    11·1 answer
  • Please tell the different parts of breast with diagram​​
    5·1 answer
  • Earths outer core is best inferred to be
    13·2 answers
  • Which of the following does not add carbon dioxide to the atmosphere?
    12·2 answers
  • help causeee i stoopid #square brain and im not good at cells and reproduction of organisms so please help the words at the top
    12·1 answer
  • Why do leukocytes have a nucleus
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!