1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
earnstyle [38]
3 years ago
9

Which of the following is not a typical pattern found in the earth's system

Biology
1 answer:
Alla [95]3 years ago
4 0
<span>Something that occurs outside the spheres of the earth
Consider that human beings or living organisms live in the biosphere. Biosphere is the collective group of living organisms and their interaction to one another and –ecosystem- to their environment. Human beings like animals or plants are part of the biosphere, one of the spheres in the earth. We have the atmosphere (air), lithosphere (land), hydrosphere (water) and the biosphere (life/ living organisms). Each is with a specific and distinctive characteristics to play in the earth’s existence at the current era.<span>
</span></span>
You might be interested in
Please help with questions 1-5 it’s due tomorrow and I’m stressing so bad rn
Finger [1]

Answer:

1. They are very small and thin. Can be seen in mitosis as they condense, but when not dividing are in loose strings.

Explanation:

2. IDK cause I don't have your results but it is likely interphase.

3. Longer

4. Replication of DNA and organelles, cell will expand

5. Growth, because they are carrying out metabolic functions and will replicate DNA and organelles in this stage.

6 0
2 years ago
. Oleander is a very hardy plant that can survive in a wide
Katarina [22]

Answer: you have to tend to it for 1 hour ever day and make sure there are no weed taking the water.

Explanation:

4 0
3 years ago
Can someone please help with this urgently. <br><br>you don't have to explain, just answer ​
Shalnov [3]

Answer:

B. option A 2 daughter cells

C. option D metaphase

7 0
3 years ago
Read 2 more answers
The key difference between fats and
Andru [333]
Phospholipids make up parts of the cell membrane and their in a whole different setting .
3 0
3 years ago
Foreign invaders have proteins called _____, which antibodies lock onto to neutralize.
stich3 [128]
Foreign invaders have proteins called antigen, which antibodies lock onto to neutralize. The foreign proteins are different from proteins in our own body, so the immune system can recognize them and finally eliminate them.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What was the most significant conclusion that gregor mendel drew from his experiments with pea plants?
    8·1 answer
  • Julie experienced inexplicable blindness. she visited several ophthalmologists, all of whom indicated there was no physical basi
    11·1 answer
  • Many biotic factors affect individuals in a population. An example of an organism being directly affected by a biotic factor is
    14·1 answer
  • How can you tell the difference between carbohydrates and lipids?
    7·1 answer
  • People who lose weight rapidly are more likely to regain the weight, leading to repeated cycles of weight loss and gain.
    15·2 answers
  • How do you think knowledge of Earth's structure provides insight into how and why these natural events happen?
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • In determining whether a particular act occurred within the scope of employment, courts will evaluate whether the employee’s act
    9·2 answers
  • The total amount of different living things is:
    7·1 answer
  • Which statement explains blood pressure?​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!