1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
8

What is meant by a balanced equation?

Biology
2 answers:
azamat3 years ago
7 0

Answer:

A balanced equation is an equation for a chemical reaction in which the number of atoms for each element in the reaction and the total charge are the same for both the reactants and the products. In other words, the mass and the charge are balanced on both sides of the reaction.

Explanation:

Step2247 [10]3 years ago
7 0

Answer:

A balanced chemical equation occurs when the number of the atoms involved in the reactants side is equal to the number of atoms in the products side.

Explanation:

For an example,

In this chemical reaction, nitrogen (N2) reacts with hydrogen (H) to produce ammonia (NH3). The reactants are nitrogen and hydrogen, and the product is ammonia.

You might be interested in
Black fur (B) in guinea pigs is dominant over white fur (b). What is the probability of finding homozygous black offspring in a
Svet_ta [14]

Answer: 100%

Explanation: If both guinea pigs are BB dominant, that means they don't have the recessive trait, so therefore no heterozygous guinea pigs will be created. This leaves 100% homozygous offspring.

8 0
1 year ago
Which of the following best defines genomics?
lara [203]
It is a complete set of an organisims gene so the aanswer would be B. the study of genomes and organisims

8 0
2 years ago
Read 2 more answers
Which of the following statements is true?
marshall27 [118]
The answer would be <span>"A niche is the role an organism has in an ecosystem."</span> Because a niche is the position or 'job' an organism has in an ecosystem. For example, the niche of certain butterflies and bees is to pollinate flowers in an ecosystem which allows them to reproduce.

4 0
3 years ago
Read 2 more answers
A piece of metal has a mass of 200 g and a volume of 2 cm3. What is its specific gravity?
Klio2033 [76]
<span>Density = mass/volume = 200g/2cm^3 = 100 g/cm^3 

Density of water = 1g/cm^3 

Specific Gravity is the ratio of the Density of the object to the Density of water so the Specific Gravity is 100 


Piece of metal has a </span>Specific Gravity if 100
7 0
3 years ago
Read 2 more answers
Most plant leaves contain yellow and orange carotenoids as well as green chlorophylls. Why then are most leaves greenish
sattari [20]

Answer:

Because the leaves contain a greater concentration of green chlorophylls than yellow and orange carotenoids.

Explanation:

Chlorophyll and carotenoids are both pigments found in the cells of organisms like plants. They have differing color range depending on which wavelength of light they absorb and which they reflect. For example, chlorophyll pigment are green because they reflect green light and absorb others.

According to this question, the leaves of most plants contain yellow and orange carotenoids in addition to green chlorophylls but leaves are mostly green. This is because there is an abundant of chlorophyll pigment than any other pigment in the leaves of most plants. Hence, GREEN COLOR conferred by chlorophyll dominates and masks the color appearance of the other accessory pigments like yellow and orange carotenoids.

8 0
2 years ago
Other questions:
  • Test your knowledge about eukaryotes by sorting the following statements according to whether they are true or false. ITEMBANK:
    6·2 answers
  • The process of water vapor turning into liquid water is called?
    12·2 answers
  • Under a light microscope, a stained cell shows chromosomes lined up along the middle. Choose from the following the next thing t
    9·2 answers
  • HELP help HELP help HELP pleaseeeeeeee
    14·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The chance that a certain event will occur is known as its
    15·1 answer
  • The figure above shows bands of DNA that were separated during gel electrophoresis.
    12·1 answer
  • 1. The Human Genome Project has demonstrated that in humans of all races and nationalities approximately 99.9 percent of the gen
    15·1 answer
  • Which of the following countries currently contributes the most lumber to the international market?
    9·1 answer
  • What path does pollen need to travel for the plant to reproduce?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!