1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saw5 [17]
4 years ago
13

Which forecasting method uses a cause-and-effect relationship to predict weather?

Biology
1 answer:
DiKsa [7]4 years ago
8 0

Answer:

Analog Method

Explanation: Method of forecasting that uses the effects of past weather conditions as part of its forecasting method; cause and effect relationships

pls mark me brainliest

You might be interested in
Are the anthers in this flower located above or below the stigma
Akimi4 [234]

Answer:

Above

Explanation:

The anthers are always above the stigma.

4 0
3 years ago
A student decides to be the subject in her own experiment. She wants to know how the amount of time she spends studying for a te
Pavel [41]

Answer:

Test Variable (independent variable)

Explanation:

X is always the independent variable/time. Test grades is dependent because it's the outcome. Trust me I took the test.

6 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Which organelle is labeled I????
Dvinal [7]
Mitochondria :) your welcome
6 0
3 years ago
Read 2 more answers
The carrying capacity of any population will remain the same...
VLD [36.1K]

...unless environmental changes occur. These probable environmental changes could influence the supply of food, the condition of shelter and the environment to sustain life and support the population.

5 0
3 years ago
Other questions:
  • Omitting Pluto, what is the last planet in the sequence of planets in our solar system?
    5·2 answers
  • Skin tanning is an example of which adaptation technique?
    12·1 answer
  • All living things are made up of carbon. This is because
    9·1 answer
  • What key question does psychology seek to answer?
    10·1 answer
  • WHAT MOST DIRECTLY ALLOWS PLANKTON TO GROW?
    5·2 answers
  • What is the probability of producing a child that will phenotypically resemble either one of the two parents in the following fo
    14·1 answer
  • Two cultures, each containing a different species of bacteria, were exposed to the same antibiotic. Explain how, after exposure
    10·2 answers
  • How many combinations of A, C, G, and U exist? Include an equation
    13·1 answer
  • During the early days of deciphering the human genome, scientists were surprised to find that the number of genes appeared to be
    10·1 answer
  • For this assignment, you will develop a scientific model on a poster that illustrates the role of photosynthesis and cellular re
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!