1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kobusy [5.1K]
3 years ago
11

What environmental changes affected the evolution of reptiles?

Biology
1 answer:
valentinak56 [21]3 years ago
7 0
<span>Earth went through a period of hot and also dry conditions and a wide spread drought.These conditions favored reptiles and therefore causing them to evolve during those conditions. Hope this helps :)</span>
You might be interested in
The diagram shows the results of meiosis. The parent cell has one pair of chromosomes. The locations of three genes are shown
Kobotan [32]

Answer:

Crossing over in the chromosomes

8 0
3 years ago
Select three organisms that pass energy to the primary consumers.
Naya [18.7K]

Answer:

A.ferns

D.small leafy plants

E.songbirds

Please Mark Brainliest If This Helped!

8 0
2 years ago
Phase 1 of the creation of life on earth was the formation of small molecules containing carbon and hydrogen. Phase 2 was the fo
snow_tiger [21]

Answer:

The correct answer will be- formation of membrane

Explanation:

The three-stage origin of life theory suggests that life on Earth originated in three phases which are:

1. Phase I: The larger molecules formation began during this unsuitable earthly conditions full of volcanic eruptions and harmful gases underwater.

2. Phase II: The self-replicating molecule begins to form during this phase which contained the coding of life. The self-replicating molecule is known as the formation of the membrane.

3.Phase III: The formation of the membrane which help separate the outer environment from the inner environment was observed during this phase.

Thus, the formation of a membrane is the correct answer.

8 0
3 years ago
According to Mendel's Law of Segregation, meiosis involves the separation of a parent organism's alleles in order to form gamete
marin [14]
B) increases the genetic variability of the offspring because there are more genes presemt
6 0
3 years ago
Benita wants to know how to identify heartworms. Which statement will help Benita?
sweet [91]

Answer: <u><em>C. They can be six to twelve inches in length.</em></u>

Explanation: I got it correct on edmentum

3 0
1 year ago
Other questions:
  • This scientist is known for his work with natural selection, and he is known as the Father of Evolution.
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What happens to Dna during sexual reproduction
    14·2 answers
  • From which sphere of earth did this food originate
    5·1 answer
  • Where do the instructions for making proteins come from
    10·1 answer
  • Drag the tiles to the correct boxes to complete the pairs.
    10·2 answers
  • Lisa is giving a speech about Pandas. Her speech includes 3 points: 1) where pandas live; 2) what pandas eat; and three) how pan
    13·1 answer
  • How does the mutation present in 10% of Europeans protect their cells from HIV?
    7·2 answers
  • Some carbohydrates, such as ______________, are used as structural material in plants. For most animals, foods that contain thes
    15·2 answers
  • According to the July 1985 New York Times article, what is to blame for the decline in the clamming industry?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!