1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoundrel [369]
3 years ago
14

1. All organisms that make their own food are called

Biology
1 answer:
slamgirl [31]3 years ago
5 0

Answer:producers

Explanation:

You might be interested in
How do leaves help with cellular reputation ?
charle [14.2K]
Photosynthesis is the process by which plants use light energy to convert carbon dioxide and water into sugars...Respiration occurs when glucose combines with oxygen to produce useable cellular energy. This energy is used to fuel growth and all of the normal functions.
6 0
3 years ago
I attached the problem below.
kkurt [141]
I would think the answer is B.) All species share a common ancestor and that change occurs through time.

- I've recently went over this again with my teacher. I hope this helps! (:
5 0
3 years ago
Factories and cars release pollutants into the atmosphere. These pollutants can dissolve in the water vapor in the atmosphere. W
stellarik [79]
Acid rain, if I understand the question correctly.
5 0
3 years ago
Read 2 more answers
What is the chemical reaction for photosynthesis
fiasKO [112]
Photosynthesis Is generally the opposite of cellular respiration. To drive the organisms metabolism photosynthesis has an exothermic reaction.
6 0
3 years ago
Someone please help!!! :)
leva [86]

Answer:

D. it changes sound waves into electric impulses.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Rods are to cones as _____ is(are) to _____. peripheral vision and night vision; color vision and visual acuity color vision and
    7·1 answer
  • A team of geologists is surveying glaciers on a mountain. They come across a newly formed stream. The stream is flowing at an av
    15·2 answers
  • Describe what will happen to the wave as it goes through the hole. what do we call this?​
    9·1 answer
  • ©
    8·1 answer
  • Which of the following describes how the endocrine system could cause blood pressure to decrease?
    10·2 answers
  • What happens when planaria grow, heal and regenerate after being cut
    14·1 answer
  • Select the correct answer. Which of the following is a chemical reaction?
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • (1) What is the most common way for a dead organism to avoid decomposition?
    7·1 answer
  • If a rat births several offspring after fertilization, why will these offspring NOT be genetically identical to the mother
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!