1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pav-90 [236]
3 years ago
8

Study the image of a plate boundary. The Asthenosphere is being divided by the Lithosphere on the left of the diagram. Oceanic c

rust is above the Lithosphere and continues until it reaches the Continental crust on the right. The Lithosphere layer on the right is moving left toward the Lithosphere layer on the left that is moving right and down. Two volcanoes are above the area where the lithosphere layers meet. Which feature is forming? mountain rift valley earthquake island chain
Biology
2 answers:
aniked [119]3 years ago
8 0

Answer:

The answer is mountains

Explanation:

The plate boundary is pushing against each other, forcing one of the tectonic plates (the weaker one) back down. The newer plate gets pushed up, forming mountains.

Amiraneli [1.4K]3 years ago
5 0

Answer:

Mountains

Explanation:

You might be interested in
What is bicorn in sican
Andrews [41]
Basically bicorn is a type of corn that feeds to animals. Sican is a type of sea creature that roams the bottom of the ocean
6 0
3 years ago
Which of the following is a quality of building ledges and roofs in urban environments that lead birds to nest there?
vichka [17]

Answer: no clue

Explanation: yeah

7 0
3 years ago
What would happen on a hot day if your brain did not receive input that your body is starting to heat up?
egoroff_w [7]

Answer:

d.

Explanation:

4 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Mountains formed by two colliding continents often contain marine _______ rock
stealth61 [152]
<span>The correct answer is Marine Sedimentary Rock. This means that when they collide, usually mountains come from out of the sea and move vertically up. This means that sedimentary marine rocks eventually become non-marine rocks since they're not in the sea anymore so they can be found on such mountains.</span><span />
4 0
3 years ago
Other questions:
  • 1. 1 <br> 2. 2 <br> 3. 3<br> 4. 4<br> 5. 5
    8·1 answer
  • Depolarization of a cell membrane occurs because
    12·1 answer
  • If a solution outside a cell is more concentrated so that the cell loses water to its environment, the external solution is said
    12·1 answer
  • Saved
    15·2 answers
  • List the 4 abiotic forms of nitrogen cycle and the chemical formula
    13·1 answer
  • What do the letters A, G, C, and T represent in nucleotides
    15·2 answers
  • A volcano erupts, killing all the organisms in an area. Eventually, small plants
    8·1 answer
  • True or false: In order to increase the speed of replication, the DNA molecule is opened at several locations creating multiple
    8·1 answer
  • Although the outer mitochondrial membrane is permeable to all small molecules, the inner mitochondrial membrane is essentially i
    9·1 answer
  • What is the difference between an infectious disease and a noninfectious disease?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!