1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stels [109]
3 years ago
15

Cold-blooded animal, feels at home in the water and on land is called

Biology
2 answers:
belka [17]3 years ago
7 0
A cold blooded animal is able to withstand extreme weather conditions, as its body adapts to its surroundings to survive and thrive
Masja [62]3 years ago
4 0
May possibly be a frog?
You might be interested in
Rearrange them in the correct sequence.
DerKrebs [107]
Tilling, Ploughing, Sowing, Manuring, Irrigation, Weeding, Harvesting.
5 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
PLEASE HELP
KATRIN_1 [288]

Answer: the answer is A

Explanation: i just did it

6 0
3 years ago
it important to know a person's rhesus factor before a blood transfusion? A patient who is Rh+ can receive only Rh– blood. A pat
timofeeve [1]

The right answer is A patient who is Rh– can receive only Rh– blood.

The blood group is not the only thing that matters, it adds a category: rhesus. Rhesus refers to a red blood cell antigen that is on their wall. There are two blood group systems: Rh positive (Rh +) and Rh negative (Rh-).

Rhesus is positive in people who have this antigen. It concerns the majority of the population. Negative rhesus refers to people without the antigen. This rhesus factor is especially useful to know if a blood transfusion is feasible between two people.

The blood transfusions can be "iso-rhesus", that is to say between Rh + and Rh- but only in one sense: Rh- can give to Rh + but Rh + can not give to Rh-. Again because of the presence of antibodies directed against the antigen in Rh- people.

4 0
3 years ago
Read 2 more answers
Hey everyone!!
nikitadnepr [17]
Asexual means by self sexual means from opposite genders
4 0
2 years ago
Other questions:
  • Which compound exhibits geometric isomerism also called cis-trans isomers? For a molecule to have geometric isomers, each C atom
    14·1 answer
  • How can plants contribute to chemical and mechanical weathering
    12·1 answer
  • Which of the following statements is FALSE?
    6·1 answer
  • 1. If a black heterozygous guinea pig is crossed with a homozygous white guinea pig with the
    6·1 answer
  • Describe any four development tasks which will be show drastic differences in a three year and a thirteen years old girl
    10·1 answer
  • What were paleocene organisms that may have been the first primates?
    11·1 answer
  • How does the suns energy effects the climate of an area
    10·1 answer
  • Describe the positive or negative impacts eco-friendly technologies could have on our cryosphere, biodiversity, and human popula
    7·1 answer
  • HELP PLEASE DUE SOON
    5·1 answer
  • How does a man find the g-spot of a woman?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!