Answer:
B) Carbon Dioxide, Water, 36 ATP
Explanation:
Cellular respiration takes A (Glucose & Oxygen) and converts it into B (Carbon Dioxide, Water, and 36 ATP)
Hope This Helped!
Answer: Organisms depend on other organisms and on the nonliving things in an ecosystem to meet their basic needs for food, water and protection. 3. Plants use energy from the sun to produce their own food from air and water.
Explanation:
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
The RNA world hypothesis states that the earlier life-forms had relied only on RNA (Ribonucleic Acid) for the purpose of catalyzing the chemical reactions, and storing the genetic information. This hypothesis was proposed by Leslie Orgel, Carl Woese, and Francis Crick.
This hypothesis states that long before the living forms evolved to use DNA as the genetic storage material, the RNA molecules served the purpose of both storing the genetic information and carrying out catalysis, but because of its instability, DNA evolved.
Hence, the answer is RNA world hypothesis.
Answer:
for light dependent , chlorophyll The pigment, sunlight and water. while for light independent co2 , ribose sugar ATP, NADPH
