1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hichkok12 [17]
2 years ago
14

What are two possible ways that making plastics for electronic devices could impact the environment

Biology
1 answer:
myrzilka [38]2 years ago
3 0

Answer:

RoHS applies to the following substances for electronic equipment and electrical appliances: lead, mercury, cadmium, hexavalent chromium, PBB (polybrominated biphenyls), and some PBDEs (polybrominated diphenyl ethers).

You might be interested in
The heart is the most
svetoff [14.1K]

Answer:

The main function of the circulatory (or cardiovascular) system is to deliver oxygen to the body tissues, whilst simultaneously removing carbon dioxide produced by metabolism.

7 0
2 years ago
Bicarbonate ions which migrate from red blood cells into the surrounding fluid are replaced by _____ ions.
Mrac [35]

Answer: chloride ions

Explanation:

This movements of  chloride ions  into the blood plasma to replace the outward diffused bicarbonate ions is  called  chloride shift, It  occurs  to restore the blood ionic balance altered by the bicarbonate ions diffusion out into plasma

The same amounts of Chloride ions replaced the lost amount of  bicarbonate ions

7 0
3 years ago
What are the TWO processes during decomposition?
otez555 [7]

Answer:

Decomposition occurs through two primary chemical processes: autolysis and putrefaction. They often occur in tandem, but one may predominate in certain conditions. Autolysis (or “self-digestion”) is the destruction of cells through the action of their own enzymes.

Explanation:

5 0
2 years ago
Read 2 more answers
Although earth is estimated to be 4.5 billion years old, and although life first appeared about 4 billion years ago, plants did
timurjin [86]
470 million years ago
3 0
3 years ago
Beekeepers and scientists are puzzled and troubled by a decline in bee populations around the world. what would you predict as a
harkovskaia [24]
The most likely consequence of the widespread lack of bees is loss or reduction of food. Majority of food depends on pollination and bees are major pollinators in the ecosystem, playing an essential role in food production among different type of plants. Bee’s declining population is mostly associated to excessive use of pesticides or toxicants in industrial agriculture as well as presence of different parasites or pathogens and even climate change.
8 0
3 years ago
Other questions:
  • List several species and several individual characteristics of dogs.
    5·1 answer
  • Cuales fueron los Descubrimientos de lamarck y darwin ?
    12·1 answer
  • A means of communicating information or art is called artistic​
    5·2 answers
  • If you are looking at your reflection in the concave side of a spoon and begin to move the spoon further away from your face, wh
    5·1 answer
  • QUICK HELP!!!!!!! Choose an organism that you are familar with, and explain how the three parts of the cell theory relate to tha
    11·1 answer
  • Which statement is true about DNA replication?
    5·1 answer
  • The guppy is a species of small freshwater fish. Many years of scientist observations revealed that the average size of guppies
    10·1 answer
  • Recognises that division of labour found in<br>multicellular organism for efficient functioning.​
    12·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • What is meant by aseptate coenocytes​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!