1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yawa3891 [41]
3 years ago
8

What would the growth equation look like for sessile populations (Sessile populations can’t move, like a barnacle)?

Biology
1 answer:
pantera1 [17]3 years ago
5 0

Answer:

births - deaths = growth

Explanation:

(births - deaths) + (immigrants - emmigrants) is what you would normally use to calculate the growth of a population, but because they can't move, you can cut out the immigrant and emmigrant part of the equation.

You might be interested in
Why is it important to know the PMI in forensics
tia_tia [17]
PMI is very important in forensics because having a time of death can help with the identification of human remains and can support or deny the stated actions of suspects in the crime.
3 0
3 years ago
Match the descriptions of the stages of the act of hearing with the correct stage order.
Nana76 [90]
Stage 1 - <span>The ear collects compression waves.
Stage 2 - </span>The ear amplifies the compression waves.
Stage 3 - <span>The amplified waves stimulate the hair cells of the ear.
Stage 4 - </span><span>The hair cells transmit nerve impulses to the brain
Stage 5 -</span><span>The brain interprets the nerve impulses.


Hope this  helps!</span>
3 0
3 years ago
Read 2 more answers
Non-flowering plants are known as seedless plants​
Dmitrij [34]

Answer:

i would say True Beauce there put in the same category

(Non-flowering and seedless plants are known as cryptogams)

5 0
2 years ago
The mass number of iodine is 126, and it’s in the 53rd place in the periodic table. It has ___ protons and ___ neutrons
igomit [66]
It has 53 protons and 73 neutrons.

(Neutrons: 126-53 = 73)

:)
3 0
3 years ago
Read 2 more answers
The process of altering the genome of one species by adding genes from another species in order to gain a beneficial trait is kn
mafiozo [28]

Answer:

Genetic engineering is the process of using recombinant DNA (rDNA) technology to alter the genetic makeup of an organism. ... Most often, a gene from another species is added to an organism's genome to give it a desired phenotype.

Explanation:

MARK AS BRAINLEST!!

5 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The process by which vesicles containing solid objects such as bacteria are fromed on the surface of a cell for transport into c
    7·1 answer
  • Identify the organs each body cavity contains
    7·1 answer
  • Which conditions are equal to stp
    12·2 answers
  • ____ intelligence is defined as involving the skills and knowledge necessary for adapting to one’s physical and social environme
    11·1 answer
  • What do you think would happen if you took an antacid prior to eating a hamburger
    6·2 answers
  • Lupus, a condition in which the body attacks its own cells, is an example ofLupus, a condition in which the body attacks its own
    14·2 answers
  • "Normal blood pressure is 120/80. What is the top number called and what is happening in the heart?"
    9·1 answer
  • You were with your younger cousin playing at the park and he has mixed up his legos in the sand.
    12·1 answer
  • 17. Which of the following is an acid?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!