1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol [13]
3 years ago
15

During replication, is the original dna sequence maintained in the new strands? explain why or why not.

Biology
2 answers:
Scorpion4ik [409]3 years ago
8 0

Answer:

During replication, is the original dna sequence maintained in the new strands.

Explanation:

DNA replication begins at one end of the double strand of DNA. The replication fork will open as the two old tapes (initial molecule) unfold in the front, while two new tapes will be synthesized below and in turn will wind in the old tapes; forming two new double strands of DNA, each containing a new strand and an old strand. For this reason, we can say that yes, during replication, the original DNA sequence is kept in the new strands.

Jobisdone [24]3 years ago
4 0
Hello!

During replication, DNA sequence is maintained in the new strands

The reason for it is the action of DNA Polymerase. This is an enzyme who has the function of "proofreading" the DNA sequence to ensure that all nucleotides are in the right order. This process is so accurate that an incorrect base is introduced every 10⁹-10¹⁰ bases. 
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
During sexual reproduction, two gametes merge to create a zygote that is a genetic mix of its two parents. For each statement, i
Elenna [48]

Answer:

1. 50% of the genome comes from each parent because it is crucial otherwise if the ratio changes, the zygote may not form and if formed the fetus may have some other kind of chromosome number related syndromes etc.

2.  Sexual reproduction produces greater genetic variability than asexual methods. This is because of the process of crossing over during meiosis that exchange the segments of chromosome that is necessary for producing mutations and genetic variability.

3. 50% of chromosomes match with each parent because both of the parents contributed 23 chromosomes and exactly 50% of their genome.

4. The gametes must be produced by two different individuals cause that is the main purpose of sexual reproduction and give better survival like this to the forming next generation. Not to mention produces greater genetic variability among species.

5. Plants always produces both eggs because they are hermaphroditic in nature.

7 0
3 years ago
Read 2 more answers
What do animals ranging from corals to monkeys have in common?
dmitriy555 [2]
Unfortunately this question is incomplete as it is a multiple choice question. The following options are provided: 
<span>A) body cavity between body wall and digestive system
B) number of embryonic tissue layers
C) type of body symmetry
D) presence of Hox genes
E) degree of cephalization

The answer is D: presence of Hox genes

</span>

Hox genes are a group of genes that determine the basic structure and orientation of animals.

3 0
3 years ago
Read 2 more answers
Photosynthesis and cellular respiration are cells ____that occur in cells.
Leviafan [203]

Answer:

A) chemical reactions.

Explanation:

"Photosynthesis is the process through which plants convert light energy into chemical energy. Here is the chemical reaction involved: As we can see, water and carbon dioxide combine to form glucose and oxygen. Since new chemical species are formed, photosynthesis is clearly a chemical change. "

7 0
3 years ago
2. <br> What organs make up the alimentary canal?
cluponka [151]

Explanation:

it consists of mouth, pharynx, gullet, stomach, small intestine, large intestine, appendix, colon, rectum, and anus.

All these parts are found in most vertebrates

5 0
2 years ago
Other questions:
  • Evaluate the age of rocks. You find 3 undisturbed rock layers. The middle layer is 120 years old. What can you say about the age
    6·2 answers
  • What unit of measurement is most appropriate for measuring the size of atoms?
    5·1 answer
  • which system is responsible for defending the body against harmful substances? A circulatory system B muscular system C endocrin
    9·2 answers
  • Lysosomes are membranous organelles that contain digestive enzymes. Lysosomes can function inside the cell, where their enzymes
    14·1 answer
  • Why are liners laid down at the bottom of a landfill before waste is deposited in the landfill?
    9·2 answers
  • How did planetesimals form?
    9·1 answer
  • Whats atp synthesis and diffusion of water?​
    12·1 answer
  • Which best describes how scientists found the human gene that makes insulin?
    15·1 answer
  • 11. When cold temperatures are produced in a chemical reaction, the reaction is
    8·1 answer
  • Which of the following best describes an ecosystem in a neighborhood garden?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!