1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoundrel [369]
3 years ago
5

Anxiety disorders are characterized by all of these symptoms except ____.anxiety disorders are characterized by all of these sym

ptoms except ____.
Biology
1 answer:
lisov135 [29]3 years ago
8 0
A person can be anxious when making an important decision when faced with a problem at work. Types of disorders are;
1. Generalized anxiety disorder symptoms include
a) irritability
b) muscle tension
c)Being easily fatigued.
2. Panic disorder symptoms include
a)feeling of being out of control during a panic attack.
b)Repeated and sudden attack of intense fear.
3. Social anxiety symptoms
a)Having a very hard time making friends.
b)feelings of self-conscious in front of other people
c)Staying away from where other people are.

You might be interested in
Autonomic nervous system includes which one of the following?
True [87]

Answer:

d

Explanation:

4 0
3 years ago
Drag the tiles to the correct boxes to complete the pairs.
Nonamiya [84]

Ans.

Platelets are a type of blood cells, responsible for blood clotting. These cells prevent excessive blood loss from wound as they form plug or clot at the site of injury to repair the damage.  Thus, the option). platelets is correctly matched with 'clotting blood.'

White blood cells or WBCs are components of immune system that protect the body from harmful foreign molecules, such as bacteria, fungi, and viruses and harmful body cells, such as tumor cells.  Thus, the option). white blood cells is correctly matched with 'fighting bacteria.'

Red blood cells or RBCs are blood cells that transport oxygen, carbon dioxide, and nutrients to the different part of the body. These cells are made up of hemoglobin and protein. Thus, the option). red blood cells is correctly matched with 'clotting blood.'

Plasma is the non-cellular, colorless, fluid portion of blood, composed of proteins, vitamins, antibodies, amino acids, and other micromolecules. It is responsible for viscous nature of blood. Thus, the option). plasma is correctly matched with 'providing viscosity to the blood.'


3 0
3 years ago
Read 2 more answers
What organelles can be found in a prokaryotic cell? Pls answer ASP.
Lilit [14]

Answer:

Cell Wall

Cell Membrane

Cytoplasm

Ribosomes

7 0
3 years ago
During asexual reproduction yeast cells can produce _____
Taya2010 [7]
Genetically identical offerings or daughter cells by binary fission
8 0
3 years ago
What is number 6 pointing to?
IceJOKER [234]
Why does that person keep putting that in the comments ugh 6
4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The spread of a tumor within the body is called _______.
    15·1 answer
  • 2. Which is not true about a wave in the open ocean?
    15·1 answer
  • Most proteins retain metabolic activity when denatured. false true
    9·1 answer
  • Which of the following applies to skeletal muscle? Select all that apply. A : moves food and substances through the GI tract B :
    15·2 answers
  • Which DNA base is referred to as a wild card due to its ability to change into one of the other bases?
    7·2 answers
  • Which of the following scientists DID NOT disprove spontaneous generation? *
    9·1 answer
  • If a parent has the trait and it appears in every generation, then the pedigree is...
    15·1 answer
  • Which evidence supports the theory of ocean floor spreading?
    13·1 answer
  • a potential cancer-causing gene coding for a protein with cell cycle control responsibilities is a(n) , and a gene coding for a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!