1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katarina [22]
3 years ago
6

Lipids are organic macromolecules that serve a variety of purposes. What is the most important role of lipids?

Biology
2 answers:
Blababa [14]3 years ago
7 0
The most important role of lipids is to store energy.
Marat540 [252]3 years ago
5 0

Answer:

The answer is energy storage.

Explanation:

Lipids are a set of organic molecules, which consist mainly of carbon and hydrogen and, to a lesser extent, oxygen. Lipids fulfill diverse functions in living organisms, including energy reserve. Lipids (usually in the form of triacylgeroles) constitute the energy reserve for late or deferred use of the organism. Their caloric content is very high (10 Kcal / gram), and they represent a compact and anhydrous form of energy storage.

You might be interested in
What is the most plentiful fossil fuel? A: oil B:Natural has C: petroleum D: coal
neonofarm [45]

Answer:

d coal

Explanation:

i need more words for it to let me post this answer blah blah

4 0
3 years ago
9) It is a warm summer night, 32oC, with the relative humidity at 100%. During the night, the air temperature drops to 18oC. You
Verdich [7]
9. It is a warm summer night, 32oC, with the relative humidity at 100%. During the night, the air temperature drops to 18oC. You would expect to see___on the ground in the morning. 

 A) dew

10. Scientists believe that during the Late Cretaceous period, many small seas dried up and new mountains began to rise. Which would MOST LIKELY cause them to believe the temperature decreased during this time?

A) The absence of fossils of warm-weather plants.

11) A hurricane is MOST LIKLEY to occur in an area

   A) near warm water.

12) A team of archaeologists excavating a sedimentary rock layer come across some primitive hunting tools used by early humans. As the dig progresses, they unearth the fossilized remains of a dinosaur from another layer of the sedimentary rock. Why do these discoveries indicate that the rocks were formed over millions of years?

C) Dinosaurs became extinct millions of years before humans appeared.

Hope I helped!

8 0
3 years ago
What is the purose of using multiple control groups in an experiment?
ELEN [110]

Answer:

well the answer is yellow

Explanation:

7 0
2 years ago
What is one way in which hurricanes are different from other types of large windstorms, such as nor'easters? A. Hurricanes can s
mel-nik [20]
D. The center or eye of a hurricane is warmer than its surroundings. I'm pretty sure that's right or it's c!
3 0
3 years ago
Which of the following expressions gives the heat of vaporization of the liquid
bezimeni [28]
(5000*85)/.06 J Celsius/kg
4 0
3 years ago
Other questions:
  • One difference between plant cells and animal cells is that only plant cells have peroxisomes. plant cells lack a cytoskeleton.
    5·1 answer
  • The field of genetic engineering in biotechnology has exciting potential for disease treatment but also raises some serious conc
    12·1 answer
  • The breakdown of starch produces which of the following?
    14·1 answer
  • PH can be regulated in the collecting duct.<br> a. True<br> b. False
    14·1 answer
  • The nucleoside analogue acyclovir, which is used to treat herpes simplex virus (HSV) infections, lacks a 3′ hydroxyl group (–OH)
    8·1 answer
  • Which group relies on topography maps to construct buildings?
    8·2 answers
  • The two genes f and g, code for body size and aggressiveness, respectively. The F allele is dominant over f, and codes for a lar
    12·1 answer
  • Which best explain why the sun maintains its size and shape
    12·1 answer
  • Which of these questions is scientific?
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!