1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GuDViN [60]
2 years ago
13

How are carbohydrate polymers formed? by hydrolysis by dehydration synthesis by replication by transcription

Biology
2 answers:
kenny6666 [7]2 years ago
6 0
I think the correct answer from the choices listed above is the second option. Carbohydrate polymers are formed by dehydration synthesis. In this process, <span>monomers combine with each other via covalent bonds to form </span>polymers<span>. Hope this answers the question.</span>
solmaris [256]2 years ago
5 0
By dehydration synthesis
You might be interested in
Mendel's law of______ governs which allele is expressed in an individual.​
allsm [11]

Answer:

Mendel stated that each individual has two alleles for each trait, one from each parent. Thus, he formed the “first rule”, the Law of Segregation, which states individuals possess two alleles and a parent passes only one allele to his/her offspring. One allele is given by the female parent and the other is given by the male parent.

Explanation:

6 0
2 years ago
Read 2 more answers
19. What's evaluated at the G2 checkpoint in mitosis and meiosis?
Vedmedyk [2.9K]

Answer:

D

Explanation:

The G2/M check point makes sure that <u>all of the chromosomes have been replicated.</u>

- <em>Is all DNA replicated?</em>

- <em>Is all DNA damage repaired?</em>

5 0
3 years ago
Read 2 more answers
What causes the "heat island" effect?
laila [671]

Answer: The answer is D mate

Explanation:

3 0
2 years ago
If the rice already had the genes that could make vitamin A, why did scientists use genes from other organisms?
meriva

Answer:

A. The rice genes didn't make the right type of vitamin A.

Explanation:

Regular white rice does not have the gene to produce beta carotene. The human body converts the beta carotene into vitamin A.

To increase the nutritional value of rice, the gene for beta carotene from daffodil flowers was inserted into the cells of endosperm of rice.

This allowed these cells of the genetically engineered rice varieties to produce beta carotene. Production of beta carotene imparted golden color to the rice grain and hence, the name.

7 0
3 years ago
Which statement best represents a hypothesis?
MaRussiya [10]

Answer:

The answer is C.) if mosquitoes are given a light in a dark room, they will fly toward the light.

Explanation:

Hope this helps :))

6 0
3 years ago
Other questions:
  • What term refers to polluted sites that can be cleaned and revamped?
    6·2 answers
  • 22. Robert Hooke, a French scientist, published Micrographia in which he described many
    5·1 answer
  • The rhomboideus minor muscle originates on which process on the vertebrae? Select to launch animation The rhomboideus minor musc
    7·1 answer
  • What happens to the amount of available energy in the pyramid as it moves up through the different levels? A) It increases. B) I
    12·2 answers
  • How does facilitated diffusion differ from simple diffusion
    6·1 answer
  • Of rocky planet which has only a thin atmosphere
    12·2 answers
  • Which is not part of the cell theory?
    6·1 answer
  • Many common products, such as wooden furniture, paper, and books, are made from trees. Which of the following is a likely conseq
    12·1 answer
  • How are genes the instruction manual in our body?​
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!