1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
4 years ago
11

i was delivered by abraham lincoln at dedication of a battlefield cemetery in pennsylvania what am i 

Geography
1 answer:
Nadusha1986 [10]4 years ago
7 0
The answer is the Gettysburg address, this is the famous speech starting as, "four score and seven years ago...."
You might be interested in
Riverhead new york has a smaller average daily temperature range than elmira new york because riverhead is located
marishachu [46]
Closer to the ocean than Elmira
8 0
4 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Examine the fifteenth-century map of Constantinople. Why would
Georgia [21]

Answer:

You would expect the city to control travel of waterways surrounding it because if they had control over water they could have control over many things. They would be able to travel and trade, and they would be able to stop attacks from people using the waterways to travel.

5 0
4 years ago
Most El Niño climate patterns involve the Earth’s atmosphere and the surface waters of the __________ Ocean. A. Arctic B. Atlant
kodGreya [7K]
B atlantic i would say

Hope it helps
7 0
3 years ago
Read 2 more answers
Does a sheet of paper accurately represent a plane?
xxMikexx [17]

Answer:

i mean it can but i personally thing graph paper is better

Explanation:

reason why is because graph had grids

4 0
3 years ago
Read 2 more answers
Other questions:
  • The regions colored __________ on the map above represent the polar climates of the world.
    15·1 answer
  • What approach to development did the Brundtland commission propose
    8·2 answers
  • When atmospheric oxygen levels began to rise, there was an increase in aerobic organisms.
    8·2 answers
  • Name the seconed lrgest continet. what is the worlds largest deseret? the worlds longest river
    12·1 answer
  • 13. A soil contains 30% smectite, 10% kaolinite, and 2% organic matter. Calculate an estimated CEC for this hypothetical soil.
    14·1 answer
  • Nutrients in the soil aid the process of energy production through photosynthesis. In this example, between which two spheres is
    6·2 answers
  • What did fertile soil mostly contribute to the Mesopotamians' trade with other civilizations?
    12·2 answers
  • E
    10·1 answer
  • Which statements are true?
    5·1 answer
  • Which of the following measurements helps us determine distance from the Prime Meridian?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!