1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrMuchimi
3 years ago
13

How are the shoulder girdle and pelvic girdle similar in structure and function

Biology
1 answer:
yulyashka [42]3 years ago
6 0

The shoulder (pectoral) and pelvic girdles are both structures for limb articulation. The shoulder girdles are to the upper limbs as the pelvic girdle is to the lower limbs. Shoulder girdles connect the upper arms with the axial skeleton and consist of the clavicle and scapula.

The pelvic girdles consist of the hip bones, the sacrum and the coccyx and are located between the abdomen and the thighs.


You might be interested in
The speed of light in water is 2.25 x 108 m/s. What is true about the index of refraction of water?
djverab [1.8K]
Light speed in water is 2.25 times 10^5 m/s so the index of refraction is higher than the index of refraction of light in a vacuum which is 1.0. (speed in vacuum for light is 300,000 km/s)

Index of refraction of light in water is 3.0 time 10^5 m/s divided by 2.25 times 10^5 m/s = 1.33.

Hope this is what you wanted.

8 0
3 years ago
Read 2 more answers
Question 41 A basement membrane anchors Multiple choice question. A) muscle tissue to nervous tissue. B) epithelial tissue to co
Leokris [45]

Answer:

B) Epithelial tissue to connective tissue

Explanation:

3 0
2 years ago
Seven cups of instant coffee contain 315 mg of caffeine.
larisa86 [58]

Answer:

45 mg of caffeine in one cup of instant coffee.

3 0
3 years ago
Read 2 more answers
How does air pollution affect our respiratory<br> system?
Ksju [112]
Breathing in air pollutants can irritate your airways. It may cause shortness of breath, coughing, wheezing, asthma episodes and chest pain. Overtime, exposure to air pollution puts you at risk for lung cancer, heart attack/strokes, etc. Some people are more at risks from others though
7 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • Eukaryotic cells contain many membrane-enclosed structures not found in prokaryotic cells. which cell structures are enclosed by
    8·1 answer
  • Match the term to its description dwarfs, giants, main sequence stars, super Giants A Did stars that shine with the last of the
    14·1 answer
  • What do you call separating water into its component elements hydrogen and oxygen and how is it done
    14·1 answer
  • A solution that causes a cell to swell because of osmosis.
    15·2 answers
  • Difference between hydra, sponge and obelia
    10·1 answer
  • "…Lo que marca el ritmo del desarrollo es el Deseo del Otro que opera sobre el niño a través de su Discurso. Lo madurativo se ma
    13·1 answer
  • Match the various types of intrusive rock.​
    12·1 answer
  • For a long time scientists have studied the cells of complex organisms. Scientists have discovered that
    10·1 answer
  • Glycogen is an important and quickly mobilized source of stored glucose. Glucose is mobilized for ATP generation in muscle in re
    15·1 answer
  • Яке біологічне значення сну​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!