1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
4 years ago
15

Where in a lake is the benthic zone?

Biology
1 answer:
elixir [45]4 years ago
3 0
C. Along the bottom. The benthic zone is the bottom sediment of a lake.
You might be interested in
The ability of water to act as a solvent for so many substances is due to its _______.
ella [17]

Answer:

B. polar nature

Explanation:

6 0
3 years ago
Which is an example of negative phototropism?
ra1l [238]
Since its negative, it means it is growing away from the light source. It's a rather odd question because plants usually grow towards the light source.
8 0
3 years ago
Read 2 more answers
This can occur when part of a population of a species becomes separated from the remainder, they may over time evolve different
Basile [38]
This definition above refers to the geographic isolation.
It means exactly what it says in the definition - one species is left behind from the rest of the population, and it stays in that particular location, evolving and changing from the species and population it was once a part of.
6 0
3 years ago
How are species richness and productivity related?
nekit [7.7K]

Answer:

Recent studies have examined the possibility that variation in species richness within communities may influence productivity leading to an exploration of the relative effect of alterations in species number per se as contrasted to the addition of productive species.

Explanation:

hope this helps

have a great day/night

6 0
3 years ago
PLEASE HELP
Usimov [2.4K]

Answer:

Peristalsis moves the food along the digestive tract.

Explanation:

brainliest?

7 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • After a major environmental change, what happens to species that do not adapt or move?
    9·2 answers
  • A sub-group of individuals who suffer from a particular disease exhibit a base-pair substitution in the messenger RNA for a prot
    8·2 answers
  • Which scenario describes unethical lab behavior?
    11·2 answers
  • The building blocks or monomers of nucleic acid molecules are called _____. See concept 5.5 (page 84) view available hint(s) the
    5·1 answer
  • The Earth’s magnetic poles create which of the following? A. a magnetic field around the earth B. magnetic resistance of Earth C
    7·1 answer
  • Pleas help me with this earth science question
    15·1 answer
  • True or False?<br><br> Convection currents produce the heat in the Earth’s interior.
    5·2 answers
  • Dhjwbsjsbsdjiwjwiwkeiw
    10·2 answers
  • Which form of water is not considered as a resource? A) groundwater B) glacial ice C) ocean water D) water vapor E) surface wate
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!