A) A metal forms a + charged ion, so D2+
B) A nonmetal forms a - charged ion, so A-
C) C2-
D) B+
Answer:
Since high ethanol is a major stress during ethanol fermentation, ethanol-tolerant yeast strains are highly desirable for ethanol production on an industrial scale. A technology called global transcriptional machinery engineering (gTME), which exploits a mutant SPT15 library that encodes the TATA-binding protein of Saccharomyces cerevisiae (Alper et al., 2006; Science 314: 1565-1568), appears to be a powerful tool. to create ethanol tolerant strains. However, the ability of the strains created to tolerate high ethanol content in rich media remains to be demonstrated. In this study, a similar strategy was used to obtain five strains with higher ethanol tolerance (ETS1-5) of S. cerevisiae. When comparing the global transcriptional profiles of two selected strains ETS2 and ETS3 with that of the control, 42 genes that were commonly regulated with a double change were identified. Of the 34 deletion mutants available in an inactivated gene library, 18 were sensitive to ethanol, suggesting that these genes were closely associated with tolerance to ethanol.
Explanation:
Eight of them were novel and most were functionally unknown. To establish a basis for future industrial applications, the iETS2 and iETS3 strains were created by integrating the SPT15 mutant alleles of ETS2 and ETS3 into the chromosomes, which also exhibited increased tolerance to ethanol and survival after ethanol shock in a rich medium. Fermentation with 20% glucose for 24 h in a bioreactor revealed that iETS2 and iETS3 grew better and produced approximately 25% more ethanol than a control strain. The performance and productivity of ethanol also improved substantially: 0.31 g / g and 2.6 g / L / h, respectively, for the control and 0.39 g / g and 3.2 g / L / h, respectively, for iETS2 and iETS3.
Therefore, our study demonstrates the utility of gTME in generating strains with increased tolerance to ethanol that resulted in increased ethanol production. Strains with increased tolerance to other stresses such as heat, fermentation inhibitors, osmotic pressure, etc., can be further created using gTME.
Answer:
Birds, like mammals, have a 4-chambered heart (2 atria & 2 ventricles), with complete separation of oxygenated and de-oxygenated blood. The right ventricle pumps blood to the lungs, while the left ventricle pumps blood to the rest of the body.
<h3>
<u>PLEASE</u><u> MARK</u><u> ME</u><u> BRAINLIEST</u></h3>
<u>
</u>
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
