1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serg [7]
3 years ago
5

What size shoe I wear?

Biology
2 answers:
otez555 [7]3 years ago
6 0
The size of the shoe you wear. is 8?
GREYUIT [131]3 years ago
5 0
Well if you look at the bottom of the shoe, the sole, or the tongue it should tell you.Hope it helps :)
You might be interested in
Two group of children pulling rope but rope doesnot move why\
Georgia [21]
There's a group on each side so there's equal pull on both sides so it doesn't move
8 0
3 years ago
You have 46 chromosomes in each of your somatic cells. If you cut your arm, how many chromosomes would be in each newly formed s
rosijanka [135]
You would have .3 of a chromosome for each new cell
7 0
3 years ago
What do many scientists believe about the purpose for asteroids.
katovenus [111]

Answer:

Various scientists describe asteroids in different ways:

  • Some scientists consider it to be rocks which orbit around the sun.
  • Other consider it to be small planets.

The majority of the scientists agree that asteroids might have come into existence at the time of solar formation. The parts which broke down during the formation of the solar system resulted in the formation of asteroids.

<u><em>Scientists believe that asteroids might not have a major function in the universe but studying them would be of great benefit. This is because as they are parts broken from the solar system, exploring them will let us know about some unknown features of the other solar system bodies. </em></u>

5 0
3 years ago
According to the diagram in which layer would most likely find coal deposits
anyanavicka [17]
Layer 10 is were you most likely find coal
8 0
3 years ago
Which picture shows the smallest building block of a living cell?<br> A <br> B<br> C<br> D
eimsori [14]

Answer:

Option A

Explanation:

Option A shows the smallest building block of a living cell.

3 0
3 years ago
Read 2 more answers
Other questions:
  • According to the principle of the conservation of mass the mass of the sodium sulfate was the following PLS HELP I NEED TO TURN
    13·1 answer
  • How are the light-dependent and light-independent reactions of photosynthesis related?
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Please please help !!
    13·1 answer
  • Which three manufactured goods does soil help people produce?
    11·1 answer
  • Tectonics plates float on the ? <br> A.outer core<br> B.inner core<br> C.mantle<br> D.lithosphere
    8·2 answers
  • I need help so pls help me ?
    11·1 answer
  • I NEED HELP ASAPPP PLEASE<br> C. When the arm extends (straightens), which muscle contracts?
    14·2 answers
  • Although a liver cell and a muscle cell in a human cell develope from the same single cell, their appearance and function is dif
    13·1 answer
  • Describe the similar seasonal changes between the butterfly in Florida and the butterfly in Wyoming during
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!