1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Firlakuza [10]
2 years ago
12

28. Carbohydrates and nucleic acids are important molecules found in living things.

Biology
1 answer:
ruslelena [56]2 years ago
5 0
28. Part A.
A nucleic has a sugar group, a phosphate group, and nitrogenous base. A carbohydrate only has the sugar group units.
Part B
Nucleic acids make up the DNA and RNA which contain the genetic material for life.
Carbohydrates are used to provide energy to the cells.
Part C
Because all life require energy and this energy can be obtained from carbohydrates.

31
Part A
The phenotype will be red flower.

Part B.
Using the Punnett Square, the results are
RR, Rr, Rr, rr
There are 3 red flower plant for every 1 white flower plant

Part C.
He should cross a wild or pure breed red flower and white flower snap dragons.
You might be interested in
In a fish species, the number of eggs that hatch and survive for one year varies depending on the number of eggs that were produ
Alenkinab [10]

Answer:

C. The chance of survival decreases when there is intraspecific competition for resources among surviving yearlings

Explanation:

The survival rate of the offspring of the fish species will decrease as a result of the huge number of eggs produced giving rise to overpopulation. Pressure will be on the limited available resources. As a result of this, Intraspecific competition would occur as members of the same fish species would compete for the limited resources.  

Interference and exploitation competition are two types of Intraspecific competition that can reduce the population size of the fish species.

For Interference competition, the dominant and stronger members would secure adequate supply of the limited resources to  detriment of the weaker and less dominant ones. This leads to the death of those members that are weak to compete successfully, thereby leading to a reduction in population size.

In exploitation competition, it involves all individual members of the fish species sharing the limited resources equally, while none of them gets an adequate amount. With time, a great size of the population decrease would be noticed when compared to that of Interference competition.  

8 0
2 years ago
what would you if cell membrane became impermeable instead of selectively permeable could cell remain alive
natali 33 [55]
If a cell membrane became impermeable, instead of selectively permeable, the cell would not remain alive, though certain organisms would be able to stay alive longer than others. This is because the cell membrane allows essential molecules and substances such as oxygen into the cell, while allowing harmful substances, like waste, out of the cell.

:)
4 0
2 years ago
Question 3 of 10
Otrada [13]

It’s A. Random!! I looked it up!
5 0
3 years ago
What molecule would be considered a covelant compound
jok3333 [9.3K]
Hydrogen atoms and one oxegyn atom
8 0
2 years ago
Read 2 more answers
The dark reaction of photosynthesis is also called the
Thepotemich [5.8K]


The dark reaction of photosynthesis is called the Calvin cycle or Calvin -  Benson cycle.

It is a series of  chemical reactions that occur in chloroplasts during photosynthesis.

It is also known as the light - independent phase because it happens after  light energy ahs been absorbed from the sun.

It is named after  scientist called Melvin Calvin who was the winner of a Nobel prize in chemistry for finding how this cycle works way back in 1961, at the university of California.


5 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following has the greatest effect on endangered species populations?
    5·1 answer
  • .
    6·1 answer
  • If spaghetti represents a carbohydrate, what organ(s) would chemically digest this macromolecule?
    6·2 answers
  • Suppose you observed 32 whitefish blastula cells. One cell was in metaphase, 3 were in anaphase, 8 were in prophase, and 4 were
    11·1 answer
  • Lips, or fats, are stored in the cells of the body as a
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Select the correct answer. Which statement correctly explains the polarity of the water molecule? A. The hydrogen end of the mol
    8·1 answer
  • Can you get scholaships for community college? What scholarships are good for community college
    14·2 answers
  • A molecule of oxygen gas contains two:<br> O molecules<br> O elements<br> O atoms
    14·2 answers
  • A Chinook salmon fish in Alaska can produce up to 17,000 eggs in a single birth. Not all of these offspring can survive, however
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!