Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Water molecules are not found in a dna molecule.
Answer:
Plants.
Explanation:
Producers is an organism in an ecosystem that can make its own food. Plants use a process called "Photosynthesis" in order to make the food it needs to survive. Other organisms have to eat a different organism in order to survive,
Thus, the answer is (A)
Given what we know, we can say that biology and neo-Darwinism both support the idea that natural selection explains how the environment selects organizations for survival or extinction.
<h3>Natural Selection. </h3>
- This concept is often summarized by the phrase "survival of the fittest".
- This refers to the ability of an organism to adapt to its environment.
- The better-adapted organisms will live to pass on their genetic information, thus changing the organization of the species.
- Those not able to do so will face extinction.
Therefore, since natural selection involves the survival or extinction of a species based solely upon their ability to adapt and change their genetic organization in response to their environment, we can say that this concept helps to explain how the environment selects organizations for survival or extinction.
To learn more about natural selection visit:
brainly.com/question/2725702?referrer=searchResults
Then solution attracts cell material towards itself by the process of osmosis...
