1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MrRissso [65]
4 years ago
6

What is the definition of energy?

Biology
1 answer:
Ulleksa [173]4 years ago
6 0
The defination to energy is B) the ability to create a new substance.
You might be interested in
If Mr. Dorji is conducting an experiment to determine the rate of photosynthesis in the presence of varing degrees of light inte
qwelly [4]

Answer:

Independent: Light intensity

Dependent: Rate of photosynthesis

Explanation:

The independent variable is the variable that changes, to determine if it has an effect on something.

The dependent variable is the variable that's measured.

Hope this helps!!

8 0
2 years ago
Plzz help!!!
Tom [10]
A , a different form of DNA containing
8 0
3 years ago
Read 2 more answers
Where is almost all of the mass in an atom located​
fiasKO [112]

most of a atoms mass is in the nucleus of the atom:) hope this helps you

3 0
3 years ago
Read 2 more answers
What Is The Definition Of Obtain​
PtichkaEL [24]

Answer:

to get, acquire or secure

3 0
3 years ago
Read 2 more answers
Which Florida natural resource is renewable?<br><br> Oil<br> Coal<br> Wood<br> Limestone
Art [367]

Answer:

I think the answer is coal

7 0
3 years ago
Other questions:
  • What is a migration
    15·2 answers
  • What kind of molecule passes through the lipid belayer of the cell membrane
    15·1 answer
  • Fertilization produces in the offspring:
    8·1 answer
  • What makes the Beggiatoa Alba interesting?<br><br> Please in your own wordsssss
    6·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • A cell in an embryo that still resembles the original cells of that embryo but will eventually form the spinal cord is ___.
    5·1 answer
  • Where is the cholestrol found in a cell membrane?
    10·2 answers
  • 8. In the 1940s, the scientist J.B.S. Haldane linked many human red blood
    14·1 answer
  • Which of the following best describe the information about the solar system
    9·1 answer
  • Rachel carson’s warning in silent spring was focused on _______. a. overgrazing by livestock b. global warming c. the misuse of
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!