Question

Assume that an error has occurred during DNA replication, and the new non-template DNA strand has a mutation in the base sequence, such that the nucleotide that is in bold and underlined (*) has been added to the normal sequence. Please decipher the new "message." non-template DNA strand +1 * 5’
GTTTGACAGCTACAGTCATGCATAAGCTATAATCAGTACCAGTGTGCAGGACATGGAAAGAATTTGATGCTTAAGCTG 3’

a. What is the sequence of the new "message?" Please use the single letter codes for each amino acid to decipher the "message." Again, show all your work.

b. What type of mutation point or Frameshift has occurred? You perform an enzymatic rate of reaction analysis on 2 mutants of an enzyme and obtain the following data (Note: these are not the mutants above)

Answer 1

Answer:

The enzyme that is responsible for adding nucleotides to the growing DNA molecule is called DNA POLYMERASE.

The principal role of DNA polymerase is to carefully and accurately add the right nucleotides to the growing DNA molecule in order to make sure that the genome is accurately replicated and the genetic information are maintained.