1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
4 years ago
6

Assume that an error has occurred during DNA replication, and the new non-template DNA strand has a mutation in the base sequenc

e, such that the nucleotide that is in bold and underlined (*) has been added to the normal sequence. Please decipher the new "message." non-template DNA strand +1 * 5’
GTTTGACAGCTACAGTCATGCATAAGCTATAATCAGTACCAGTGTGCAGGACATGGAAAGAATTTGATGCTTAAGCTG 3’

a. What is the sequence of the new "message?" Please use the single letter codes for each amino acid to decipher the "message." Again, show all your work.

b. What type of mutation point or Frameshift has occurred? You perform an enzymatic rate of reaction analysis on 2 mutants of an enzyme and obtain the following data (Note: these are not the mutants above)
Biology
1 answer:
nikitadnepr [17]4 years ago
7 0

Answer:

The enzyme that is responsible for adding nucleotides to the growing DNA molecule is called DNA POLYMERASE.

The principal role of DNA polymerase is to carefully and accurately add the right nucleotides to the growing DNA molecule in order to make sure that the genome is accurately replicated and the genetic information are maintained.

You might be interested in
Conjugation is the direct transfer of dna from one bacterium to another. occurs when a phage transfers bacterial dna from one ba
Reptile [31]
Conjugation is the direct transfer of DNA from one bacterium to another.
Bacteria can exchange genetic information through three different mechanisms; conjugation, transduction, and transformation. Bacterial conjugation involves the transfer of a plasmid from one bacterium to the other, through cell-to-cell contact. Bacterial transduction is performed through bacteriophages. Bacterial transformation refers to the process of moving genetic elements to various positions of the genome.

7 0
4 years ago
List two main functions of Proteins
dezoksy [38]
1. Balances fluids.
2. Structure. Support for tissues.
6 0
3 years ago
Bicuspid valve prevents backflow into
ehidna [41]

prevents backflow into the left atrium

5 0
3 years ago
Science is limited to investigation of topics for which evidence can be gained through experiments and/or observation.
Illusion [34]

Answer:

Letter A - True

Explanation:

Science is in fact limited to topics in which evidence can be gained through experiments and/or observations.

This happens because to realize science, scientists have to strictly follow the scientific method. And in this method, essential steps are observation, formulation of hypothesis and experimentation.

It is also important to note that not all knowledge can be covered by the scientific method, this does not mean that it is not valid, just that it is not science.

7 0
4 years ago
During coastal upwelling, nutrient-rich water rises from the ocean floor to the surface to replace water that has been blown awa
Firdavs [7]

Answer: A. Increase in temperature

Coastal upwelling is the process in which the deep water rises above the top most water level as the wind pushes water offshore. Nutrients which are present in the bottom layer get available to organisms living in the uppermost layer. The deeper water lacks oxygen because the decomposition of organic matter at the bottom of the water body consumes up available oxygen. Also, because of these water layer turnover will result in thermocline: temperature variation among the layers of water. Bottom layer water because of such decomposition processes will have more temperature when this water rises in the upper layer due to upwelling this will increase the temperature of the upper layer.


7 0
3 years ago
Read 2 more answers
Other questions:
  • SO IS IT A OR B ??????!!!!!!!
    11·1 answer
  • Which sentence represents a hypothesis? environmental conditions affect the pollination of plants. boil 100 milliliters of water
    12·1 answer
  • What change occurs during oxidation?
    15·1 answer
  • What conclusions can you draw about the relationship between light intensity and the rate of photosynthesis?
    7·1 answer
  • A blood platelet drifts along with the flow of blood through an artery that is partially blocked by deposits. As the platelet mo
    11·1 answer
  • Easy question. Please answer should include explanation.
    11·1 answer
  • What is the animal organelle name <br> order 1-15.
    9·2 answers
  • Compares and contrasts transformation, transduction, and conjugation
    15·1 answer
  • Throughout, make sure you have a copy of the Student Guide and your data table.
    12·1 answer
  • Why are antibiotics unhelpful for treating the common cold?.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!