1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
4 years ago
6

Assume that an error has occurred during DNA replication, and the new non-template DNA strand has a mutation in the base sequenc

e, such that the nucleotide that is in bold and underlined (*) has been added to the normal sequence. Please decipher the new "message." non-template DNA strand +1 * 5’
GTTTGACAGCTACAGTCATGCATAAGCTATAATCAGTACCAGTGTGCAGGACATGGAAAGAATTTGATGCTTAAGCTG 3’

a. What is the sequence of the new "message?" Please use the single letter codes for each amino acid to decipher the "message." Again, show all your work.

b. What type of mutation point or Frameshift has occurred? You perform an enzymatic rate of reaction analysis on 2 mutants of an enzyme and obtain the following data (Note: these are not the mutants above)
Biology
1 answer:
nikitadnepr [17]4 years ago
7 0

Answer:

The enzyme that is responsible for adding nucleotides to the growing DNA molecule is called DNA POLYMERASE.

The principal role of DNA polymerase is to carefully and accurately add the right nucleotides to the growing DNA molecule in order to make sure that the genome is accurately replicated and the genetic information are maintained.

You might be interested in
You know that (1) both
adoni [48]

Complete question

  • It has to be E. coli because it is positive for gapA
  • It can't be Salmonella, because it is negative for the invA marker but still makes people sick
  • It has to be used because it is positive for the apeE marker

Answer:

<u>1. It can't be Salmonella, because it is negative for the invA marker but still makes people sick </u>

  • A combination of positive results from the multiplex PCR inva, apee and gapa is used to definitively identify Salmonella.  
  • Pathogenic, or disease causing Salmonella is definitely not present, as inva is required for it to be pathogenic. The test did not detect the inva sequence, thus it is truly negative for this particular pathogen.

<u>2. It has to be E. coli because it is positive for gapA </u>

  • E. coli may be present, as gapa was detected- a presumptive positive. However, this may need to be definitively determined through further methods of sample analysis, such as 2D-gel electrophoresis.
  • apee may belong to another type of bacteria present within the initial sample, or there may be sample contamination

Explanation:

Polymerase chain reactions, PCRs are a form of nucleic acid amplification testing NAAT that exploit the mechanism of transcription by using a thermostable DNA polymerase. These require a sample of genetic material such as RNA or DNA; specific regions of the gene sequence are targeted for replication by primers.  In the presence of these specific gene sequences, the primers make billions of copies of the sequences.

However, if these gene sequences are absent, the primers are not capable of identifying and amplifying the sequence. This reaction is highly specific. Positives obtained have a high chance of being true positives and negatives have a high chance of being true negatives .

Pathogens or infectious agents that are capable of causing disease i.e. making people sick. Both E. coli and Salmonella are genuses of enteric bacteria capable of causing disease via fecal contamination. Common symptoms include

  • abdominal cramps
  • vomiting
  • fever
  • diarrhea

This test would include primers for the detection of each sequence: gapa, apee, inva. Salmonella's inva was not detected, thus it is not present.

Further steps may include a 2 D gel  electrophoresis- here an electrical current is utilized to separate bands of DNA within the sample. This should correspond with an expected DNA  size in base pairs or bp  for E.coli- this should be determined by running the sample in the gel with a positive control, containing genetic material for E coli, and a negative control, of purified water to determine contamination.

7 0
4 years ago
In order for organisms to pass on genetic information to offspring, they may
Reika [66]
The parent must copy its own DNA and provide a copy to its offspring.

or Reproductive.
6 0
3 years ago
Read 2 more answers
Why do pond organisms live in shallow water ?
Trava [24]
Pond organisms live in shallow water so they can produce
8 0
3 years ago
Is light an external or internal stimulus for a plant?
wariber [46]
They are both external and internal can cause a response or resulting reaction
8 0
3 years ago
The purpose of the menstrual cycle is to _____.
lesya692 [45]
Expel an unfertilized egg and endometrium.
That's what it's for, it basically flushes the not needed stuff out of a woman's uterus. 

4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe pioneer species. What types of environments do they like?
    8·1 answer
  • Directional selection only occurs in response to naturally occurring events.
    9·2 answers
  • Your patient is a​ 54-year-old male with a history of diabetes who is currently unresponsive. you have initiated​ high-flow oxyg
    11·1 answer
  • In which location would an ocean ridge most likely be located
    6·1 answer
  • How do genes determine the traits of an organism? Explain in detail
    13·1 answer
  • Yeasts life cycle is categorized as
    12·2 answers
  • Help plz help this is great minds of science on edge2020
    7·1 answer
  • Describe how chromosomes and genes are related. (3 points)
    15·2 answers
  • Rupert is studying two different cells. His professor asks him to determine which cell is a plant cell and which is a fungal cel
    7·1 answer
  • Use the graph to find the factorization of x2 - 7x+12.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!