1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leviafan [203]
3 years ago
8

The growth rate of a local population is dependent on the birth rate minus the death rate and

Biology
1 answer:
Pavel [41]3 years ago
4 0
The answer is immigration rate minus emigration rate.

Emigration is a movement of organisms from the region of settle. So, when organisms leave a population, they emigrate.

Immigration is the opposite process of the emigration in which organism move to some area. 

Population change depends on several factors: birth, death, immigration and emigration. If population size is increased, then the death rate must be less than the birth rate. Also, emigration rate must be less than immigration rate. So, to increase population it is necessary for birth and immigration to be higher than death and emigration.

You might be interested in
Help i’m confused ???
OverLord2011 [107]

Answer:

anaphase for the first one be cause the chromosomes are being pulled away by centrioles.

metaphase for the second one because the chromosomes are in the middle and centrioles are attached to them, getting ready for anaphase.

telophase for the third one since the cells are separating.

prophase for the last one.

8 0
3 years ago
2. Codominance: Diricrawls are plump, fluffy-feathered, flightless birds. Feather color
mixer [17]

Answer:

The correct answer is - 50% or 1/2.

Explanation:

In codominance both alleles express their traits and blend to make new traits, there is no dominance or recessive pattern found. In this question, there is FF have pink feathers, PP has purple feathers and mottled diriclaws (FP). Then a cross between pink feathers and mottled diriclaws would produce offspring:

    F     F

F  FF  FF

P  FP  FP

Here two out of four have pink feathers. That is 50%

4 0
3 years ago
Colorblindness is caused by a recessive x-linked gene. a woman that is heterozygous for this trait marries a man with normal col
IrinaK [193]

Answer;

The offsprings will be such that , a normal vision female, a heterozygous female, normal male and a colorblind male.

Explanation;

-Most X-linked traits in humans are recessive. One example of an X-linked trait is red-green colorblindness. Let (Xc) represent the recessive allele that causes colorblindness and (XC) represent the normal dominant allele. Females that are XCXC or XCXc have normal color vision, while XcXc females are colorblind. For males with; XcY are color blind, while those with XCY are have normal color vision.

Heterozygous female, XcXC

Normal male, XCY

The offspring of the parents, XcXC x XCY, are: XcXC (heterozygous female), XCXC( normal vision female), XCY (normal vision male), XcY (color blind male).

7 0
3 years ago
Which of the following helps to safeguard biodiversity?
AnnyKZ [126]

The answer is A, Using reusable shopping bags at stores

6 0
3 years ago
Read 2 more answers
why was is important to take the test subject's heart rate and blood pressure while sitting quietly with eyes closed
VashaNatasha [74]

the importance of this procedure is to get a set of data to compare your other test results to, like when they are active

7 0
3 years ago
Other questions:
  • A 72-year-old woman with complaints of increasing fatigue has completed a series of fecal occult blood tests that indicate the p
    8·1 answer
  • Will give Branliest!
    9·1 answer
  • Rank the following in order from most acidic to least acidic.
    13·2 answers
  • What is the relationship between water clarity and kelp productivity?
    12·1 answer
  • Most of the exchange surfaces of multicellular animals are lined with _____.
    13·1 answer
  • Which animal adaptation is well-suited for the canopy of a tropical rainforest?
    11·1 answer
  • Someone please help me I will mark you BRAINLIST I need help with all 6 questions please
    15·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The uneven distribution of Earth's resources is the result of.
    15·2 answers
  • How many centimeters are there in kilometers
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!