So if you think of a pyramid, the highest rank is on top, the order goes
1. Brahmins (highest rank or most respected) - priests, and the academic class
2. Kshatriyas - Rulers, administrators, and warriors
3. Vaishyas - artists, tradesmen, farmers, merchants
4. Shudras - commoners, peasants, servants
5. Dalits/outcastes/untouchables - street sweepers, latrine cleaners
Hope this helped a bit!
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer: Convective
Explanation:
Convective Lifting is arguably the most common form of lifting and involves the heating of the Earth's surface such that surface water gets evapotranspirated from the ground and plants.
As the clouds rise, they encounter cooler temperatures and thus cool down and condense into clouds. Higher temperatures mean higher convection.
The Amazon lies on the Equator which receives the most direct sunlight so the surface gets heated a lot. Water therefore collects faster and condenses more over the Amazon which leads to more precipitation over the Rainforest.
The answer is seafloor spreading
They both orbit around the sun. They both have moons, rings, and colored bands. They both have gas giants.
