1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anettt [7]
3 years ago
7

Most of Earth's fresh surface water is found in _____. rivers lakes streams aquifers

Biology
2 answers:
mestny [16]3 years ago
8 0
<h3><u>Answer;</u></h3>

aquifers

<h3><u>Explanation;</u></h3>
  • <u>Most liquid freshwater is found under the Earth's surface as groundwater or aquifers, while the rest is found in lakes, rivers, and streams, and water vapor in the sky. </u>
  • About 68% of freshwater is found in glaciers and icecaps such as in Greenland, the poles, and other glaciers. Another 30% is found in groundwater, which basically means aquifers. Only 1% of freshwater is found in surface water such as lakes, rivers, etc.
Alenkinab [10]3 years ago
5 0

Most of Earth's fresh surface water is found in aquifers.

You might be interested in
A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
padilas [110]

Answer:

Explanation:

a. The template strand is:

ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT

The coding strand is

TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA

The sequence encoding the five amino acids is: 3' CTA-ATC-AGA-CCG-TAC-CAT 5'

b. 5' AUG-GUA-CGG-UCU-GAU-UAG 3'

c. N terminus Met-Val-Arg-Ser-Asp C terminus

d. GGAGGA

e. The shine Delgarno sequence as a mRNA binding site for mRNA's binding to the small subunit ribosome.

4 0
3 years ago
Ionotropic receptors found at synapses are operated via _____.
sashaice [31]
Out of the following given choices;
A) excitatory, but not inhibitory, synapses
B) inhibitory, but not excitatory, synapses
C) electrical synapses
D) ligand-gated ion channels

The answer is D. These are transmembrane ion-channel proteins that open to allow ions such as Na, K, Ca, and/or Cl to pass through the membrane in response to the binding of a chemical messenger (i.e. a ligand), such as a neurotransmitter.
6 0
4 years ago
You have just delivered a premature baby. Your assessment reveals that he is breathing adequately; however, his heart rate is 90
s2008m [1.1K]

Answer:

The answer is letter B, keep him warm and ventilate with BVM.

Explanation:

In order to know more about the answer, let's check out the meaning of "Premature Baby" first.

Premature Baby- a baby born through premature birth <em>(fewer than 37 weeks).</em>  Babies are normally born at the usual <em>40 weeks.</em> Health problems may occur with premature babies, thus it is very important to monitor them.  

In the situation above, the premature baby's heart rate is only 90 beats/min. <em>A resting heart rate for a newborn infant is 130-150 beats per minute. </em>This means that the baby above has a slow heart rate. In order to increase the hear rate, it is important to keep the baby warm and to ventilate with a "Bag Valve Mask" (BVM). <u><em>An increase in internal temperature increases the heart rate. Increasing ventilation will also help increase the heart rate. </em></u>

<u><em>Remember: </em></u>Inhalation increases the heart rate.

4 0
3 years ago
How is a Punnett square used to determine the probability of inheriting genes?
Elena L [17]

Answer:

By looking at the different possibilities.

Explanation:

By looking at which letters correspond to which, you can tell what the chances are of being what.

Have a nice day! :)

7 0
3 years ago
Please answer asap! will give brainliest if correct!
Nadusha1986 [10]

Answer:

True

Explanation:

They are an invasive species

6 0
3 years ago
Read 2 more answers
Other questions:
  • You observe a tissue under a microscope. There appears to be a lumen on one side of the tissue. Lining this lumen, the cells see
    10·1 answer
  • For this assignment, you will ask questions about the factors that have caused a rise in global temperatures over the past centu
    6·1 answer
  • Learn the reactants and products for each stage of photosynthesis, and where in the plant cell does each stage occur.
    10·1 answer
  • Retroviruses are associated with human cancers, including
    7·1 answer
  • ANSWER ASAP PLEASEEEEEE!!!!!! ILL GIVE 100 POINTS!!
    12·1 answer
  • Most acid precipitation results from the combination of _____ with water in the atmosphere, forming strong acids that fall with
    14·1 answer
  • The function of glomerulus and Bowman's capsule of the nephron is to?
    14·1 answer
  • Which two Macromolecules are involved in energy
    10·1 answer
  • 11. In the carbon-fixing stage, ATP and NADPH are used to convert CO2 into?
    14·2 answers
  • The initiation of DNA synthesis on the lagging strand requires the formation of a RNA primer. True or False
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!