More often. please correct me if I am wrong
A- on the sides you would find the phosphate and sugar so the center is the AT or CG
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Performance can be impaired by a fluid-related decrease in body weight of as little as 1 percent. Dehydration is assumed to be a major adverse effect associated with rapid loss of body mass and this impairs the level of performance in an individual.
Answer:
Some challenges animals might face when migrating are disease, global climate change, overexploitation, and habitat destruction.
Explanation:
In virtually every corner of the globe, migratory animals face a growing array of threats, including habitat destruction, overexploitation, disease, and global climate change. Saving the great migrations will be one of the most difficult conservation challenges of the 21st century.
