1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bezimeni [28]
3 years ago
9

Which of the following occurs during the ecological succession of an ecosystem?

Biology
2 answers:
sergey [27]3 years ago
8 0

The answer is <span>c. Living organisms modify their environment a little at a time.</span>


The purpose of succession is for an ecosystem to reach balance state right after it is formed or after it is disturbed by man or some disasters. It will increase biodiversity and help to prevent the desertification. Living organisms modify environment a little at a time. By modifying it, they make the environment more suitable for the new species to enter the community.

olchik [2.2K]3 years ago
5 0

Answer:

Lesson 8: Ecosystem Changes Over Time

1.What is one difference between primary and secondary succession?

A. Secondary succession begins on soil and primary succession begins on newly exposed surfaces.

2. A tropical rain forest may be unable to be returned to its original climax community after which of the following disturbances?

B. Clearing and Farming

3.  Which of the following occurs during the ecological succession of an ecosystem?

C. Living organisms modify their environment a little at a time.

4. A parking lot paved with asphalt is abandoned. Describe the parking lot 5 years after its abandonment.

B. Large patches of asphalt remain bur small plants grow in many cracks in the asphalt

5.Rank the following disturbances to a forest area in order of the length of time (shortest to longest) needed for recovery of the forest.

B) Ice Storm, Tornado, Logging.

You might be interested in
Which would best be described as abiotic?
marysya [2.9K]

Answer:

An abiotic factor is a non-living part of an ecosystem that shapes its environment.

4 0
2 years ago
Read 2 more answers
How does technology benefit our understanding of<br> the ocean?
Cloud [144]

Answer:

Technology helps is by providing us with tools to pinpoint high and low spots in the ocean, it also helps us by giving us the tools we need to be able to search and find animals/plants in the ocean and then test them to see how they live/feed in the ocean.

3 0
3 years ago
DONT ANSWER ALL THE PAGES JUST ANSWER THE LAST 2 PLAGES<br> giving brainliuest
Nataliya [291]

Answer:

31. Seatbelts lock in place to make sure you don't go flying into the windshield.

32. Friction causes the soccer ball to slow down. If we were to kick a soccer ball in space, where there is no friction, it would keep on rolling until it eventually hits something or goes out of sight.

33. Heavier loads will make the vehicle move off of the table. The heavier the weight, the quicker the  vehicle will roll. Loads that are something very similar or lighter than the vehicle won't make the vehicle move by any means.

34. Gravity is the power pulling the piano toward the Earth.

Friction would happen with an unpleasant surface, making it a lot harder to push the piano up the ramp.

35. Wagon C

Wagon C has the least boxes and minimal measure of mass, making it simplest to move.

36. I would move the crates so every cart has a similar measure of boxes, making them equivalent in mass. This would make them all take a similar measure of power to move them.

Explanation: I have the answer key

7 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Answer and I will give you brainiliest <br><br><br>Please heeeeeeelp<br><br>Biology ​
icang [17]

Answer:

Absence of a nucleus

Explanation:

In eukaryotic cells, DNA is typically harvested and saved in the nucleus, though prokaryotic cells lack a nucleus, so the DNA merely floats in the cytoplasm instead.

4 0
3 years ago
Other questions:
  • Explain the Digestive system in human beings
    12·1 answer
  • The purpose of a taxonomic system is to allow for a scientific _____________ throughout the world.
    13·2 answers
  • Which of the following conditions will maximize the amount of interest you earn?
    5·2 answers
  • Choose an ecosystem near you. list three organisms in the ecosystem and describe limiting factors for each of them
    8·1 answer
  • Why might a cell make lots of rRNA but only one copy of DNA?​
    15·1 answer
  • A stem cell is:
    8·2 answers
  • Which of the following resources do goats contribute to society?
    15·2 answers
  • Blood sugar levels of the body need to be maintained, along with what other internal condition?
    5·1 answer
  • An alligator can run 1000 meters in 200 seconds what is the speed
    6·1 answer
  • What was the purpose of invubatring the unopened plates?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!