1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha_Volkova [10]
3 years ago
15

A blockage in _________ vessels would most likely cause a myocardial infarction in the lateral right side of the heart

Biology
1 answer:
Kobotan [32]3 years ago
4 0

Answer:

Coronary Artery

Explanation:

A blockage by blood clot formation is coronary artery called as thrombus reduces the blood flow to the heart. The reduced blood flow causes the heart to dysfunction and the myocardial infarction occurs. Heart tissue can sustain serious damage upon such a shock.

You might be interested in
What characteristics do only vertebrates have?
kogti [31]
Vertebrates have back bones or spines that give there body support.
4 0
2 years ago
A very old vending machine accepts only nickels (n) and dimes (d). Candy costs up to $0.50, but sometimes the machine will dispe
Hatshy [7]
This is the inequation that leads to all the ways possible to obtain candy

7 0
3 years ago
PLZZ HELP!
andrew-mc [135]

Answer:

nucleus is the answer your welcome

7 0
2 years ago
Read 2 more answers
I need help!!!!!!!!!!!!!!!!
ale4655 [162]

<em>Answer:</em>

C. Many, many years of deposition

<em>Explanation:</em>

The layers of the rocks in one region of the parks are smooth and distinct, which are evidence of many, many years of deposition.

The layers on the rocks are because of different deposition of sediments. Different sediments deposited over the rocks through the wind, water, and ice over the ages.

Have a beautiful day.

8 0
3 years ago
Read 2 more answers
Complete the sentence about Alfred wegener's continental drift story.
kirza4 [7]

Answer:

The presence of similar <u>fossils(B)</u><u> </u> and <u>rock formations(C)</u> on several different continents supports the theory of Continental Drift.

Explanation:

Alfred Wegener observed fossils of organisms that were not supposed to have survived in the climate of where they were found. Other key findings is that he found fossils of organisms that were found in one continent and the same fossils found on another continent whose edges seem to fit together.

He also observed rock formations or stratas of mountain ranges in one continent seem to fit together with another continent.

<u>Added note:</u>

Even if Alfred Wegener had these evidences to present, his theory of Continental Drift was rejected mainly because he could not explain the mechanism of how the super continent (Pangaea) split.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Jose and Karl were both exposed to the influenza virus at work. Jose had a flu shot made from killed influenza virus six weeks a
    9·2 answers
  • Which process allows a mammal to continue to grow in size
    15·1 answer
  • Lithium and oxygen react to form lithium oxide. What is the balanced equation for this reaction?
    12·1 answer
  • How a synthetic sponge mimics a live sponge to pick up dirt
    13·1 answer
  • What carbohydrate provides energy for cows but only dietary fiber for humans?
    11·2 answers
  • What are the two possible fates of heat energy that come from the sun?
    5·1 answer
  • When plants respire, what gas is released into the atmosphere?​
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • What is the advantage of radial symmetry for sessile animals such as hydras and bilateral symmetry for mobile animals such as pl
    8·1 answer
  • The lymphatic vessels comprise a special type of what system
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!