1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RoseWind [281]
3 years ago
14

If a person combat the disease without a vaccine introduced to his body,such immunity is known as

Biology
1 answer:
KengaRu [80]3 years ago
5 0

Answer:natural active immunity

Explanation:lol it took too long

You might be interested in
Chad drew a diagram to compare animal cells and bacterial cells.
liraira [26]
Answer: dna

Explanation: plants have cell walls and they both have a nucleus and they both have ribosomes
3 0
3 years ago
Read 2 more answers
Muscle cells are typically high in the number of mitochondria. Why do you think this is the case?
DerKrebs [107]

Answer: it's because they need to provide a lot of energy.

Explanation: fat cells have many mitochondria because they store a lot of energy. Muscle cells have many mitochondria, which allows them to respond quickly to the need for doing work.

3 0
3 years ago
Which part of a seed plant develops into sprem cells?
bekas [8.4K]
Sperm cells inside the pollen grain travel down the pollen tube and into the ovary which contains the ovules. Fertilization occurs when one of the sperm cells fuses with the egg inside of an ovule
4 0
3 years ago
Predict how the removal of an herbivore from a food web could affect the entire community
katrin [286]
Plants and animals live in interacting, interwined communities. There is a characteristic set of species in different environments. For example, certain species of trees, shrubs, ground cover, arthropods, reptiles, mammals, birds etc. live in a temperate forest environment. A completely different set of creatures live in a marsh, or a grassland or an agroecosystem. However, the relationships between these groups can be defined by the ecological role they play, the flow of energy between them and the cycling of nutrients between them. This is a fancy way of saying "everything is connected"! And if you change one part of the system, something else changes. In an ecosystem management decision, you hope you know what those consequences of your actions are!) This is important in managing agroecosystems as well.
5 0
3 years ago
What is standard operating procedure in biotechnology​
timofeeve [1]

Answer:

An SOP is a procedure specific to your operation that describes the activities necessary to complete tasks in accordance with industry regulations, provincial laws or even just your own standards for running your business.

Explanation:

8 0
3 years ago
Other questions:
  • During what period are kcalorie needs per unit of body weight the highest
    14·1 answer
  • What two layers of the plant contain chloroplasts
    6·1 answer
  • The sequence of ________ in mRNA complements the sequence in the DNA template. Pls answer
    7·1 answer
  • Name a natural polymer
    7·2 answers
  • Why do certain bacteria become endospores?
    7·1 answer
  • Identify specific phases of mitosis: prophase, metaphase, anaphase, telophase
    5·1 answer
  • Que es un ecosistema? ​
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • 1. Write out the reaction equation for photosynthesis. Explain where the
    10·1 answer
  • Which enzyme starts the process of DNA replication
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!