1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
5

Monosaccharides are quickly and absorbed and readily used in cell respiration to release energy list the three key examples of 6

-carbon monosaccharides.
Biology
1 answer:
Shalnov [3]3 years ago
3 0
Glucose fructose galactose
You might be interested in
What is the location of the stem where the leaf connects
adoni [48]
Nodes. Leaves are attached the plant stem at areas called nodes .
6 0
3 years ago
Which of the following best describes what causes water molecules to exhibit properties such as cohesive and adhesive behavior?
Delvig [45]
Water molecules are polar, having partially positive and partially negative ends.

trust me..
idk how to explain
8 0
3 years ago
Read 2 more answers
What is graywater please help it is for a test that is really important
sergey [27]

Answer:

Gray water is somewhat (mostly) clean waste water. It can be from baths, sinks, kitchen appliances, and more.

5 0
3 years ago
Why is the world so round?!?!
belka [17]
Because gravity pulls towards the center of the earth evenly in all directions, giving earth a spherical shape.
6 0
3 years ago
Read 2 more answers
Which is a difference between a compound light microscope and a transmission electron microscope? A.The compound light microscop
lapo4ka [179]

Answer:

While a light microscope uses light to illuminate specimens and glass lenses to magnify images, an electron microscope uses a beam of electrons to illuminate specimens and magnetic lenses to magnify images. The resolution (the level of image detailing) is the main difference between these two microscopes.

A compound light microscope is a microscope with more than one lens and its own light source. In this type of microscope, there are ocular lenses in the binocular eyepieces and objective lenses in a rotating nose piece closer to the specimen.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which mutation provided an advantage for food collecting, but was detrimental when it came to food eating?
    5·2 answers
  • "_____ championed the position called constructivism."
    11·1 answer
  • Remains or traces of organisms preserved in rock are called _______.
    7·2 answers
  • Which set of details correctly identifies a series of events in a sympathetic pathway?
    7·1 answer
  • Based on your investigation, what challenges do scientists face when classifying a new fossil?
    5·1 answer
  • You are enjoying a spring day but expect a storm to arrive soon. As the storm arrives and the rain begins to fall, you notice th
    12·1 answer
  • What are 3 things to know about gravity?
    15·1 answer
  • Plate tectonics is driven by moving within the asthenosphere
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why did Mendel use pea plants in his experiments?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!